Labshake search
Citations for Takara Bio :
551 - 600 of 2227 citations for 6H 1 2 Thiazine 6 ethoxy 5 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... TetO/NGN2 gene expression was induced by Doxycycline (2 μg/mL; Clontech, Madison, WI) on day 0 ...
-
bioRxiv - Immunology 2022Quote: ... 2 μl of the pre-RT-PCR2 (PrimeScript™ II Reverse Transcriptase, Takara Bio) mix was added to each well ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5.0 μL of 2×SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China), and 3 μL deionized water ...
-
bioRxiv - Plant Biology 2021Quote: ... The Yeastmaker Yeast Transformation System 2 was used according to the manufacturer’s instructions (Clontech). pGBK-53 and pGADT were used as positive controls ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was produced from 2 mg overall RNA with AMV reversed transcriptive enzyme (TaKaRa) as per the supplier’s instruction ...
-
bioRxiv - Plant Biology 2021Quote: ... and c-DNA was prepared using 2 µg total RNA samples (Takara Bio, UK). The c-DNA samples were diluted ten times and an aliquot of 2 µl of each sample per reaction was used for qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... Transformants were selected on Synthetic Defined (SD) medium lacking Leu and Trp (−2) (Clontech). Three individual transformants were grown overnight in liquid SD (−2 ...
-
bioRxiv - Plant Biology 2021Quote: ... Reactions were performed by mixing 2 μL 5x In-Fusion HD enzyme mix (Clontech), 100 ng of linearized vector ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μl reaction mixture contained 10 μl 2×TB green Premix DimerEraser (Takara), 1 μl of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... specific primer sets for SARS-CoV-2 and PrimeSTAR GXL DNA polymerase (TaKaRa Bio). The 5’ termini of RNA were amplified by using the 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Biochemistry 2021Quote: ... wt and mutants was induced by treatment with 2 μg/ml Doxycycline (631311, Clontech) for 24-48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was performed using PrimeScript RT Master Mix (CD201-2, TaKaRa, Otsu, Japan), and qPCR was performed using SYBR Premix Ex Taq II (RR820L ...
-
bioRxiv - Immunology 2021Quote: ... The RNA of the SARS-CoV-2 was extracted for reverse transcription (TAKARA, Japan). The SARS-CoV-2 was quantitative analyzed with real time PCR by targeting S protein.
-
bioRxiv - Cancer Biology 2022Quote: ... 2 µg of plasmids were diluted in 200 µL Xfect transfection reagent (631317, Takara). The mixture was incubated at room temperature for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; Takara, Dalian, China), 0.8 μL of each primer (Table 1) ...
-
bioRxiv - Cell Biology 2022Quote: ... and the supernatant was incubated with 2 mL TALON Metal Affinity Resin (Takara Bio) for 1 h at 4 °C with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... followed by RT-PCR using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa) with primers no ...
-
bioRxiv - Neuroscience 2022Quote: ... The titer of AAVs was measured by using AAVproR titration kit ver.2 (Takara).
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (Takara, Beijing, China), 0.8 μL of 10 μM bidirectional primers (Table 1) ...
-
bioRxiv - Bioengineering 2023Quote: ... 37°C for 2 hours in a plate coated with Retronectin (Takara Bio, T100B) with an MOI of ∼5.0 for each lentivirus (dCas9 lentivirus at MOI ∼5.0 and gRNA-MCP-fusion effector lentivirus) ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-dsRed (Clontech, 1:500-1:1000), Sheep anti-GFP (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:200-1:500, Clontech), mouse anti-1D4 anti-Fasciclin II (1:10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pre-cleared by centrifugation at 1000xg for 5 min and concentrated by 40X using Lenti-X (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... We added 5 μl of transformants (107/mL) on SD/–Leu/–Trp (Clontech, Mountain View, CA, USA) and SD/–Ade/– His/–Leu/–Trp (3 mM 3-AT ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PGCs and EGCs were lysed at room temperature for 5 minutes in lysis buffer (Takara Bio, #635013) containing RNAse inhibitors (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara) and cDNA synthesized with SuperScriptIII (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB] ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the supernatant was loaded onto a 5 ml column with prewashed Talon resin (Clontech Laboratories, Inc, CA). The column was washed three times with the low pH buffer (pH 6.3) ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-linked (1:2000, Takara, japan, Cat#T7122A-1);
-
bioRxiv - Molecular Biology 2021Quote: ... HRP-linked (1:2000, Takara, Japan, Cat# T7122A-1).
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit anti-dsRed (Takara 632496, 1:1,000–1:2,000), and Chicken anti-GFP (Aves GFP-1020 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single embryos were collected in 2 µl RNase free water with Recombinant RNase inhibitor (TAKARA) and ruptured with an RNase free needle ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR amplification was carried out using the Advantage GC 2 PCR Kit (Clontech Catalog #639119), and cloning was carried out using standard procedures (primer sequences are listed below).
-
bioRxiv - Biophysics 2019Quote: ... The supernatant was incubated with 2 mL TALON resin (Takara, Saint-Germain-en-Laye, France) in a tube using a rotation shaker for 30-60 minutes ...
-
bioRxiv - Genomics 2021Quote: ... and 2) the reduction of the amount of PrimeStar GXL DNA Polymerase kit (Takara, Japan) from 2 ul to 1 ul per reaction.