Labshake search
Citations for Takara Bio :
1 - 50 of 125 citations for 6 fluorohexanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 mM maleic acid buffer pH 5.5) containing 100 mg Yatalase (Takara) and 100 mg Lysing Enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 6 μL of Reverse Transcriptase Buffer (5x First strand buffer (TaKaRa 639538), Betaine (Sigma B0300 ...
-
bioRxiv - Molecular Biology 2021Quote: ... transferred onto nitrocellulose and detected with either mouse anti-6×His (Clontech) at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript ...
-
bioRxiv - Molecular Biology 2020Quote: ... EBs were transferred into coated 6-well plates (DEF-CS COAT, Takara) at a density of 30 EBs per well in IVD medium and harvested after 7 days.
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... in 6-well plates pre-coated with 15 ug retronectin (Takara T100A). Plates were spinfected by centrifugation at 2500 rpm 32C for 90 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 6 ml Lenti-X Concentrator (Takara Bio; Cat. No. 631231), mixed thoroughly ...
-
bioRxiv - Microbiology 2023Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction mixtures mixed with a 6×loading buffer (Takara, Beijing, China) were loaded into the gel ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Immunology 2022Quote: ... or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara). RNA was reverse transcribed with SuperScript III RT and random primers (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × 106 PBMCs were plated on retronectin coated 6-well plates (Takara Clonetech) with retroviral vectors and centrifuged at 1,000 × g for 40 min ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... target proteins were purified from cell lysate by Ni-iminodiacetic acid affinity chromatography (Clontech). However ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration was determined by bicinchoninic acid assay using bovine serum albumin (TaKaRa Bio) as the reference standard ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Developmental Biology 2019Quote: ... New York)-coated 6-well plates in N2B27-containing NDiff 227 medium (Takara Bio Inc., Shiga, Japan) supplemented with 20 ng/mL activin A ...
-
bioRxiv - Developmental Biology 2022Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Cell Biology 2024Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Genomics 2019Quote: ... and the expression of IFN-β and IL-6 were measured by quantitative PCR (TAKARA, RR820A). The sequences of the primers were listed in the Supplementary Table 4.
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Molecular Biology 2020Quote: ... Aliquots of total RNA (1 μg) were reverse transcribed using pd(N)6 random primer (Takara Bio) and Moloney murine leukemia virus (M-MLV ...
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hpi using the CellAmp Direct RNA Prep Kit (3732; Takara, Japan). The RNA was then diluted in water and boiled ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...