Labshake search
Citations for Takara Bio :
351 - 400 of 2613 citations for 6 Oxabicyclo 3.1.0 hexane 2 ethanol 4 4 difluoro 3 hydroxy 1S 1 α 2 bta 3 bta 5 α 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... according to the manufacturer’s protocol.Briefly the total RNA was isolated from TNF-α-treated with Trizol reagent (Takara Bio, Daian, China). cDNA was synthesized from 1 μg of total RNA with Prime Script II (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... were run onto 8% SDS- polyacrylamide gels that were transferred to nitrocellulose membranes which were reacted with α-His tag antibody (#631212, Clontech). Quantitation of band intensities was done with ImageLab software (BioRad) ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was performed with GeneAce SYBR qPCR Mix α No ROX (Nippon Gene, Tokyo, Japan) in Thermal Cycler Dice Real Time System II (Takara). Each Actin1 genes (PtActin1 and TpActin1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Neuroscience 2024Quote: ... After the addition of 5 µl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) to the cap ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq DNA polymerase 4 units (Takara Inc., Dalian, China), and milli-Q water approximately 37 μL ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were incubated overnight at 4° C with anti-rabbit tdTomato (1:2000; TaKaRa, Cat# 632543, RRID:AB_2307319), anti-rabbit GFP (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... The extract was incubated for 1 h at 4 °C with Talon resin (Clontech, Mountain View, CA), loaded onto a column ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Immunology 2022Quote: ... TCR α- and β-chain genes were reverse transcribed and amplified from the RNA using the SMARTer RACE Kit (Clontech Laboratories, Inc). The amplified TCR genes were sub-cloned into the pEF- 1α/pENTR vector (Addgene ...
-
bioRxiv - Plant Biology 2023Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal and supplemented with 0.2 µg/ml Aureobasidin A (Takara Bio, USA). Plates were imaged after incubation for 60–72 hr at 30 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...