Labshake search
Citations for Takara Bio :
251 - 300 of 813 citations for 6 OXABICYCLO 3.2.1 OCT 3 EN 7 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used the Matchmaker® Gold Yeast One-Hybrid Library Screening System (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative PCR was performed using a One Step TB Green PrimeScript RT–PCR Kit II (Takara, #RR086A) on a LightCycler 2.0 instrument (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... The two DNA fragments were then ligated into one plasmid with the InFusion HD cloning kit (Takara).
-
bioRxiv - Microbiology 2021Quote: ... and MSN4 were measured by RT-PCR using One Step SYBR PrimeScript RT–PCR Kit II (TaKaRa). Reactions were run on Mx3005P qPCR System (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the Retro-X™ Tet-One™ Inducible Expression System (Puro) (TakaRa Bio USA, Cat #634307). The CSF3R construct was cloned into a Gateway-converted pMSCV-IRES-GFP vector (a gift from Tannishtha Reya ...
-
bioRxiv - Cell Biology 2023Quote: ... The real-time PCR reaction was performed using One Step SYBR Prime Script RT-PCR Kit (TakaRa). The primers for 14-3-3β ...
-
bioRxiv - Microbiology 2023Quote: ... The culture was then split in half and one tube received 40ul 2ug/ul anhydrotetracycline (Takara, 631310) to induce GFP expression ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR mix (15 ul) contained One step TB Green RT-PCR kit (RR096A, Takara Bio Inc.), each primer ...
-
bioRxiv - Microbiology 2023Quote: Amplification and detection were performed using the One Step PrimeScript™ RT-PCR Kit (RR064A, Takara Bio) with the following primers targeting the IAV M segment ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using a one-step PrimeScript RT-PCR kit (Takara Bio, Cat. RR057B, Japan) as per the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... using the Takara One Step TB Green PrimeScript™ RT-PCR kit (Takara Bio Inc., Shiga, JP) and the Roche LightCycler® 96 real-time PCR instrument (Roche Applied Science ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Immunology 2019Quote: ... Rab 5 and Rab 7 cDNA (a gift of M. Sandor) and human CD81 cDNA (Open Biosystems) were cloned into pmCherry-N1 vector (Clontech). Raji/DC-SIGN cells were electroporated with 1 µg of indicated plasmid using the Eppendorf Multiporator in iso-osmolar electroporation buffer using a 90 µs ...
-
bioRxiv - Biochemistry 2022Quote: ... 127926 and 127924). shTnsB mutants (Fig. 7) were generated in the pHelper vector using the In-Fusion cloning kit from Takara and primers containing the desired point mutations ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral transduction of murine alveolar macrophages was performed for 7 days in the presence of 5 μg/cm2 RetroNectin (Takara). Stable gene expression was confirmed by GFP signals using a BZ-X710 (KEYENCE ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 × 106 HEK293T cells were transfected with 7 μg of Env expressor and 1 μg of a green fluorescent protein (GFP) expressor (pIRES2-EGFP; Clontech) with the calcium phosphate method ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was amplified using PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, Shiga, Japan) under the following reaction conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and one μg RNA was converted to cDNA by using the PrimeScript™ RT-PCR Kit (Takara, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... a one-step reverse transcription-PCR (RT-PCR) assay was conducted with a PrimeScript kit (Takara, Tokyo, Japan), and Viral genomic terminal sequences were determined using commercial 5’ and 3’ RACE (rapid amplification of cDNA ends ...
-
bioRxiv - Immunology 2020Quote: ... q-RT-PCR was performed using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time; TaKaRa). The primers used for q-RT-PCR were selected to be specific for the E and ORF1ab sequences in the SARS-CoV-2 genome (Table 1) ...
-
bioRxiv - Bioengineering 2021Quote: ... One microgram of RNA was reverse transcribed into cDNA using a PrimeScript™ RT reagent Kit (TaKaRa, RR037A) in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was reverse transcribed to cDNA using RevertAid First Strand cDNA Synthesis Kit (TaKaRa) and stem-loop primers ...
-
bioRxiv - Plant Biology 2021Quote: ... one microgram of DNase-treated RNA was used for reverse transcription using a PrimerScript RT reagent kit (Takara) and a mix of oligo poli-dT and random hexamers ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed using the One Step TB Green PrimeScript PLUS RT-PCR Kit (RR096A, TaKaRa, Japan) and a Thermal Cycler Dice Real Time System TP800 (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... cultures were split into two 2-ml cultures of which one was supplemented with 250 nM rapalog (Clontech). Mislocalisation of the target protein was verified by live-cell microscopy.
-
bioRxiv - Synthetic Biology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). Amplified products were sequenced and verified after cloning into a pJET1.2-T vector through CloneJET PCR Cloning Kit (Thermo Scientific ...
-
bioRxiv - Physiology 2024Quote: ... Three volumes of concentrated virus medium were subsequently mixed with one volume of Lenti-X concentrator (Takara Bio) and rotated at 4°C overnight before centrifugation (1500 g for 45 min at 4°C) ...
-
bioRxiv - Zoology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). The PCR procedure was set as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... we confirmed successful repair by extracting mRNA and performing one step RT-PCR (Takara Primescript High Fidelity, RR057B). Primer sequences and design are detailed in Supplementary Fig 1 ...
-
bioRxiv - Immunology 2024Quote: ... A stable IFN-λ-expressing cell line was obtained by transfection of one million Lenti-X (HEK293T, Takara) cells with 500 ng Super PiggyBac Transposase vector and 1250 ng of PiggyBac transposase mammalian expression vector using Lipofectamine 3000 following to the manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Molecular Biology 2022Quote: ... ceranae-inoculated workers’ midguts at 7 dpi and 10 dpi were respectively isolated using RNA Extraction Kit (TaKaRa company, Dalian, China). cDNA was synthesized through reverse transcription with oligo dT primer and used as templates for qPCR assay ...