Labshake search
Citations for Takara Bio :
1 - 50 of 103 citations for 6 MeO BTA 0 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... thaliana Col-0 cDNA library (Takara Bio) transformed into the Saccharomyces cerevisiae Y187 strain (prey strain ...
-
bioRxiv - Plant Biology 2020Quote: ... total RNA isolated from Col-0 plants (RNAiso Plus; Takara) was reverse transcribed (iScript™ cDNA Synthesis Kit ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were treated with 0-500 ng/mL doxycycline (Takara Bio) 48 h prior sample collection ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were treated with 0-500 ng/mL doxycycline (Takara Bio) and imaged in an Incucyte Live-Cell Analysis system (Sartorius ...
-
bioRxiv - Microbiology 2020Quote: ... approximately 0.6 million HEK239T cells were transfected with 1 μg pcLdGITRD-3-κB vector in each well of a 12-well culture dish and treated with varying concentrations (0, 0.5, 1.0, 2.5, 4.0 and to 5.0 μM) of Shield1 (#632189, Takara Clontech). After 48 h of transfection ...
-
bioRxiv - Microbiology 2020Quote: ... approximately 0.6 million HEK239T cells were transfected with 1 μg pcLdGITRD-3-κB vector in each well of a 12-well culture dish and treated with varying concentrations (0, 0.5, 1.0, 2.5, 4.0 and to 5.0 μM) of Shield1 (#632189, Takara Clontech). After 48 h of transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 h and 0 h before extracting total RNA by MiniBEST Universal RNA Extraction Kit (Takara). The abundances of the interest genes were detected measured in each time point by real-time quantitative PCR (qPCR ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from Col-0 and mutant seedlings using an RNAiso Plus kit (Takara). Complementary DNAs (cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... a DNA fragment of AT1G13390 was amplified from Col-0 genomic DNA using CloneAmp HiFi PCR Premix (Clontech) with primers listed in Table S7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Plant Biology 2020Quote: ... the promoter region of GELP38pro was PCR-amplified from Col-0 genomic DNA and cloned into linearized p1R4-ML:XVE (Siligato et al., 2016) with KpnI enzyme by Infusion (Takara) cloning to produce the inducible GELP38proXVE promoter clone ...
-
bioRxiv - Cell Biology 2021Quote: ... pLL5.0-EGFP-HRasC20 was generated by insertion of EGFP-HRasC20 fragment which was amplified from pEGFP-F (#6074-1; Clontech) by PCR into pLL5.0 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... Aliquots of 2.0 ug of the total RNA were collected for cDNA synthesis by using Clontech Oligo dT cDNA synthesis kit (Takara Bio USA ...
-
bioRxiv - Plant Biology 2023Quote: ... A genomic fragment containing the promotor region and full-length coding region of ATPC1 (At4g04640) was amplified from Col-0 genomic DNA by PCR using PrimeSTAR DNA polymerase (TaKaRa) and the primers ATPC1_F (CACCCATGGAGAGGGCTCGTACCTTAC ...
-
bioRxiv - Plant Biology 2024Quote: ... the VRN5 genomic region including endogenous promoter and terminator were amplified from genomic Col-0 DNA and cloned into pENTR using In-Fusion cloning (Takara). SYFP2 was then inserted with In-Fusion cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... and varying amounts (0, 10, 20, 100, 200 ng) of pAAV MyoD expression vectors into AAVpro 293T cells (Takara Bio) using the FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Genomics 2022Quote: The genomic DNA of Mir-0 accession (ID 8337) was used as a template (2 ng) for amplification using PrimeSTAR® GXL DNA Polymerase (TaKaRa), in a 40-µl PCR reaction with 0.3 µM primers OP009 and OP010 ...
-
bioRxiv - Biochemistry 2023Quote: ... The fusion between the core of the AGA1 promoter (-150 to 0) and the STL1 upstream activation sequence (-800 to -163) was generated by In-Fusion cloning (Takara Bio) into a plasmid containing the 24xPP7 stem loops ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells grown in 10 ml of medium (3.0 x 105 cells/ml) were transfected with 10 µg of pCAGGS-NP (1-450) using TransIT-293 Reagent (Takara, Shiga, Japan). Three days post-transfection ...
-
bioRxiv - Plant Biology 2023Quote: ... and ARR1 (2070 bp) was generated using cDNA of Col-0 as template and ligated into T-vector pMD20 (Takara Bio, Japan). All the primers used for cloning were listed in Table S1 ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...
-
bioRxiv - Microbiology 2021Quote: ... 6 μL of Reverse Transcriptase Buffer (5x First strand buffer (TaKaRa 639538), Betaine (Sigma B0300 ...
-
bioRxiv - Molecular Biology 2021Quote: ... transferred onto nitrocellulose and detected with either mouse anti-6×His (Clontech) at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript ...
-
bioRxiv - Molecular Biology 2020Quote: ... EBs were transferred into coated 6-well plates (DEF-CS COAT, Takara) at a density of 30 EBs per well in IVD medium and harvested after 7 days.
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... in 6-well plates pre-coated with 15 ug retronectin (Takara T100A). Plates were spinfected by centrifugation at 2500 rpm 32C for 90 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 6 ml Lenti-X Concentrator (Takara Bio; Cat. No. 631231), mixed thoroughly ...
-
bioRxiv - Microbiology 2023Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction mixtures mixed with a 6×loading buffer (Takara, Beijing, China) were loaded into the gel ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Immunology 2022Quote: ... or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara). RNA was reverse transcribed with SuperScript III RT and random primers (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × 106 PBMCs were plated on retronectin coated 6-well plates (Takara Clonetech) with retroviral vectors and centrifuged at 1,000 × g for 40 min ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Developmental Biology 2019Quote: ... New York)-coated 6-well plates in N2B27-containing NDiff 227 medium (Takara Bio Inc., Shiga, Japan) supplemented with 20 ng/mL activin A ...
-
bioRxiv - Developmental Biology 2022Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Cell Biology 2024Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Genomics 2019Quote: ... and the expression of IFN-β and IL-6 were measured by quantitative PCR (TAKARA, RR820A). The sequences of the primers were listed in the Supplementary Table 4.
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...