Labshake search
Citations for Takara Bio :
1 - 50 of 562 citations for 6 Iodo 1H indole 3 carboxylic acid methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% normal donkey serum) for 1h at room temperature followed by incubation in primary antibodies (rabbit anti Ds-red, Takara, cat# 632496 ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Microbiology 2021Quote: ... complementary to the DENV 3’UTR at 65°C for 3 hrs using ExpressHyb hybridization buffer (Clontech). Autoradiographs were quantified using ImageQuant (GE Healthcare).
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... cerevisiae strain AH109 (Matchmaker 3 system, Clontech) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 3’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...