Labshake search
Citations for Takara Bio :
301 - 350 of 1831 citations for 6 Fluoro 1 3 benzodioxene 8 carbonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... The stability of the fusion constructs was verified by gel electrophoresis and immunoblotting using an anti-GFP primary antibody (JL-8 monoclonal, Takara). Point mutations were introduced by site-directed mutagenesis (New England Biosciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV1-syn-F14F15S-sTpEptTA_v2 were made by transfecting 8×15c plates (per virus) of HEK 293T cells using Xfect transfection reagent (Takara 631318). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins corresponding to the full-neck regions of myosin VIIIs were solubilized using 8 M urea and purified using a Ni-NTA His60 column (Takara), or for GST-tandem-IQ fusions ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hpi using the CellAmp Direct RNA Prep Kit (3732; Takara, Japan). The RNA was then diluted in water and boiled ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was amplified using 8 µl of the PCR MasterMix (SMART-Seq v5 Ultra Low Input RNA Kit for Sequencing, Takara Bio) with 25 cycles of amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were stained with Ponceau S solution and then incubated with anti-GFP antibody (JL-8 Takara Bio Clontech, Lot #A8034133).
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were stained with Ponceau S solution and then incubated with anti-GFP antibody (JL-8 Takara Bio Clontech, Lot #A8034133).
-
bioRxiv - Molecular Biology 2022Quote: ... The complete EIAV gag-pol gene was PCR amplified from the molecular clone pCMV3-8 and inserted into the pEGFP-N1 vector (Clontech, USA) to construct the plasmid pGP ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from 8-week-old wild-type or Inka2-/- mice forebrains using the RNAiso Plus reagents (Takara Bio). PolyA+ mRNA was extracted from total RNA using Oligotex TM-dT30 mRNA Purification Kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... were run onto 8% SDS- polyacrylamide gels that were transferred to nitrocellulose membranes which were reacted with α-His tag antibody (#631212, Clontech). Quantitation of band intensities was done with ImageLab software (BioRad) ...
-
bioRxiv - Neuroscience 2023Quote: ... 48-52 mCherry-positive cells from each mouse were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/µL; Takara Cat#ST0764). For retrograde transsynaptic tracing ...
-
bioRxiv - Cell Biology 2019Quote: ... approximately 6 μg RNA was applied for 1st-strand cDNA synthesis using PrimeScriptTM RT Reagent Kit (TaKaRa, AK6003) with oligo (dT ...
-
bioRxiv - Bioengineering 2020Quote: ... concentrated lentivirus was added to non-TC treated 6-well plates which were coated with retronectin (Takara #T100B) according to manufacturer’s instructions and spun at 1200 x g for 90 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high-quality RNA (RIN > 8) was further processed for cDNA synthesis with SMART-Seq v4 Ultra Low Input RNA Kit (Clontech cat. 634888) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg of high-quality total RNA (RNA integrity number > 8) was fragmented in the presence of Mg2+ in SMARTScribe Reverse Transcriptase buffer (Clontech, Cat. 639537), and mRNA fragments with a poly(A ...
-
bioRxiv - Neuroscience 2023Quote: ... Arr3 and Arr3-derived constructs were detected with rabbit anti-Arr3 (Ahmed et al., 2007) or mouse anti-GFP (Clontech JL-8) antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA fragments larger than 3 kb were amplified with PrimeSTAR Max (Clontech Laboratories, Inc.); all other PCR products were amplified with PrimeSTAR HS DNA polymerase (Clontech Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).