Labshake search
Citations for Takara Bio :
51 - 100 of 972 citations for 6 ETHYL 4 METHYL PYRAN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Microbiology 2023Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C with permanent mixing (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed using One Step SYBR PrimeScript RT-PCR kit (Takara Bio) on a 7900HT real-time system (Applied Biosystems).
-
bioRxiv - Immunology 2021Quote: ... utilizing the PrimeScript™ One-Step RT-PCR kit (Takara Bio, Shiga, Japan). PCR products were then separated and visualized by agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... One µg of total RNA was reverse-transcribed using PrimeScript RT reagent (TaKaRa) with oligo dT primers ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized using the one-step PrimeScript RT-PCR Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... A One Step SYBR® PrimeScript™ qPCR kit (TaKaRa Bio, Otsu, Japan) was used to synthesize cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2022Quote: ... was performed with one-step Prime script III RT-qPCR mix (Takara, Japan). The viral RNA of NP was detected by 2019-nCoV-N1 probe (Cat#10006770 ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram of total RNA and the PrimeScript RT reagent kit (Takara Bio.) were used to perform the first-strand cDNA synthesis ...
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of cDNA was added to the PCR-reaction premix (Takara Bio) with 10 pM corresponding primer pairs ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR was carried out using the One Step RNA PCR Kit (TaKaRa Biotechnology Dalian ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes 55 ...
-
bioRxiv - Genetics 2023Quote: ... Initially the Matchmaker® Gold Yeast One-Hybrid Library Screening System (Takara Bio) was employed ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Bioengineering 2024Quote: ... mixed with one-tenth of the volume of Lenti-X Concentrator (Takara Bio), and incubated at 4 °C for 24 h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pHISi-1 vector was provided by the Matchmaker one-hybrid kit (Clontech, CA). The 40 bp promoter sequence was originally cloned from the maize C1 gene promoter (22) ...
-
bioRxiv - Genetics 2019Quote: ... One microgram of RNA was then reverse transcribed using Primescript RT Reagent (Takara, RR047A). Quantitative PCR was performed using Fast Sybr Green Master mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... Use the One Step TB Green® PrimeScript™ PLUS RT-PCR Kit (Takara) to quantify the viral RNA copies through the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Bioengineering 2020Quote: ... Then qPCR was conducted with a One-Step PrimeScrip RT-PCR Kit (Takara, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The sgRNA library was prepared using a one-step PCR with ExTaq polymerase (Takara) and a mixture of P5 forward primers with staggers from 1 to 8 bp and barcoded P7 reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara, Kyoto, Japan). Preparation of PCR reactions was automated by the Echo 525 Acoustic Liquid Handler (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... using the One-Step TB Green® PrimeScript™ RT-PCR Kit II (Takara) for RT-PCR ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...