Labshake search
Citations for Takara Bio :
1 - 50 of 1205 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP (JL-8, Clontech) or Vinculin (7F9 ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was pre-amplified by adding 2 uL of cDNA from each sample to 8 uL of preamp master mix [5 uL TaKaRa premix Taq polymerase (Clontech), 2.5 uL 0.2X Taqman pooled probe ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Developmental Biology 2022Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Cell Biology 2024Quote: ... transfected at 6–8 hours with 0.75 μg of DNA using Xfect Transfection reagent (Clontech) and then analysed 2 days after.
-
bioRxiv - Cell Biology 2022Quote: ... GFP (JL-8, Clontech, #632381). Secondary antibodies used included ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP (632381,JL-8, Takara), p-VASP (3111 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 µl Cloning Enhancer (Takara) was added to 20 µl of the PCR product and incubated for 15 min at 37 °C on a thermocycler ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Immunology 2019Quote: ... GFP (JL-8; RRID:AB_10013427) from Takara Bio (Kusatsu ...
-
bioRxiv - Neuroscience 2024Quote: ... GFP (1:1,000, JL-8, Clontech), GABARAP/Atg8a (1:2,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Living Colors (GFP) (JL-8, 632380, Clontech), α-Tubulin (DM1A ...
-
bioRxiv - Developmental Biology 2019Quote: ... A monoclonal GFP antibody (JL-8; Clontech) and a monoclonal HA antibody (sc-7392 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP clone JL-8 (Takara 632381) 0.5 µg/mL ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Cell Biology 2023Quote: ... mAb clone JL-8 (632381) from Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Clone JL-8; Clontech) at 1:1,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... mAb clone JL-8 (632381) from Takara Bio.
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-GFP (JL-8 clone, Takara Bio) or mouse anti-alpha-tubulin (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 8 μL of RNase-free water (Takara). The experiment of each sample was performed more than three times on a newly prepared printing chip and PCR substrate ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-GFP monoclonal antibody JL-8 (632381, Clontech) was used at 1/3000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred into 8 µL lysis buffer (Clontech SMARTer Ultra Low Input RNA Kit for Sequencing - v3) ...
-
bioRxiv - Microbiology 2023Quote: ... GFP tag (JL-8 monoclonal antibody from Takara), and mCherry (polyclonal antibody from Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... 350 ng RNA samples in 6 µL nuclease-free water) were generated using the Clontech SMARTer smRNA-Seq kit using 8 PCR cycles (Takara Bio). 30 µL of the PCR reaction was purified with AMPure XP beads (Beckman Coulter A63880 ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-GFP JL-8 (1:1000, Clontech 632380), polyclonal rabbit anti-RP2 (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary Antibodies: anti-GFP (JL-8; Clontech, 1:1000), anti-Flag (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal anti-GFP (Living Colors JL-8, Clontech), or a monoclonal anti-β-actin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-GFP JL-8 (cat. no. 632381, Takara) used at a concentration of 1:2,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Protamine sulfate (Final concentration: 8 μg/ml, Takara Bio) was added ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... mRNA was isolated using PrepX PolyA-8 protocol (Takara 640098). The mRNA samples were then processed for cDNA preparation using PrepX mRNA-8 (Takara 640096 ...
-
bioRxiv - Genetics 2020Quote: Custom oligonucleotides containing 8-OHdG bases were purchased from Takara Bio Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), rabbit anti-GFP (Chromotek ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), mouse anti-Dhc (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...