Labshake search
Citations for Takara Bio :
1 - 50 of 844 citations for 6 Chloro N methyl 5 nitro 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Cell Biology 2024Quote: ... and human adult heart RNA (n=4 pooled, Cat #636583, Takara) were used for bulk RNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Molecular Biology 2020Quote: ... Aliquots of total RNA (1 μg) were reverse transcribed using pd(N)6 random primer (Takara Bio) and Moloney murine leukemia virus (M-MLV ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Immunology 2022Quote: ... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant (5 ml) was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and incubated for 4 h at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Physiology 2020Quote: ... N-glycosidase F (PNGase, Takara, 4450) was used as previously reported [22] ...
-
bioRxiv - Microbiology 2023Quote: ... lytic-induced or uninduced cells (5×105 cells on a 6-well plate) were harvested with 500 μL of RNAiso Plus (Takara Bio). Total RNA was extracted ...
-
bioRxiv - Systems Biology 2020Quote: ... or pCMV-HA-N vector (Clontech #635690), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... and cloned into pmRFP-N vectors (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (University of Utah) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The H2afx coding sequence from Mus musculus was ordered from Eurofins and cloned into the pOZ-N-FH backbone adding the 1xHA tag at the N terminus using the in-fusion HD cloning kit (#12141, Takara). Full length wild type H2afx coding sequence was then mutagenized to obtain the desired S139A point mutation.
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Random Primer (nonadeoxyribonucleotide mix: pd(N)9) (TaKaRa) from the total RNA of Ophiocordyceps sp ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and VL648-N were cultured in YPDA (Takara, 630464) or SD-Trp Broth (Takara ...
-
bioRxiv - Microbiology 2024Quote: ... pCMV-Myc-N (635689; Clontech, Mountain View, CA, USA), and pEGFP-C3 (#6082-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and/or 1:200 anti-N-cadherin antibodies (TAKARA, M110) in 1% blocking regent (Roche ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminally and subcloned into pMSCV-IRES-Thy 1.1 vector (Clontech) using EcoRI and ClaI restriction sites.
-
bioRxiv - Cell Biology 2024Quote: ... and cloned into pCMV-HA-N or pCMV-HA-C (Clontech). Notably ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... FcγRIIA cDNA was cloned into a pEGFP-N vector (Takara Bio USA, CA). FTractin cDNA was fused with Halo tag in pTriEx-4 vector (Millipore Sigma ...