Labshake search
Citations for Takara Bio :
201 - 250 of 2246 citations for 6 Chloro 1 phenylsulfonyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM dithiothreitol (Clontech), 2 μM template switching oligo (Exiqon) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... DNA was purified using the standard phenol-chloroform extract method and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for DRIPc-seq library construction ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Immunology 2022Quote: ... or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara). RNA was reverse transcribed with SuperScript III RT and random primers (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids for Env and associated mutants in addition to Gag were natively expressed from the reference HIV-1 clone NL4-3 with the following modifications: the pNL4-3 vector was sub-cloned into an SV40 ori-containing backbone (pN1 vector; Clontech; pSVNL4-3), deletion of pol by removal of the BclI-NsiI fragment ...
-
bioRxiv - Molecular Biology 2019Quote: The transcription initiation and termination sites of OGRU were detected by 5’ and 3’ RACE using a SMARTer® RACE 5’/3’ Kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... at a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Cell Biology 2019Quote: ... using the two-hybrid system Matchmaker 3 from Clontech, strain AH109 was co-transformed with derivates of pGBKT7-DS and pGADT7-Sfi (Appendix Table S4 ...
-
bioRxiv - Immunology 2021Quote: ... and 3 U Recombinant RNase Inhibitor (Takara, Cat#2313A), sealed and immediately frozen on dry ice ...
-
bioRxiv - Microbiology 2023Quote: ... to amplify the 3’ end and CloneAmp (Takara Bio) for amplification of the 5’ end.
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Developmental Biology 2021Quote: ... was inserted in a Tol2 vector containing the hsp70l:xxxp2a-TFP sequence (kind gift from Prof. B. Martin, Stony Brooks University, NY) by In Fusion (Clontech) cloning ...
-
bioRxiv - Biochemistry 2020Quote: ... Amplified genes were cloned into an altered pFastBacHT B vector using the In-Fusion HD EcoDry Cloning Kit (Clontech). After transformation of DH10EMBacY E ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... which corresponds to the S23Q/L24M mutant of SARS-CoV-2 Wuhan-Hu-1 ORF3b *57) was generated by overlap extension PCR by using PrimeSTAR GXL DNA polymerase (Takara), the SARS-CoV-2 ORF3b 155* as the template ...