Labshake search
Citations for Takara Bio :
101 - 150 of 2217 citations for 6 CHLORO 2 METHYLIMIDAZO 1 2 A PYRIDINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... followed by selection with 2 μg/ml puromycin (Clontech). (For the sequences of shSIRT6 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 2× SYBR Green qPCR Mix Kit (TaKaRa, Japan) and the cDNA concentration and primers described above were used ...
-
bioRxiv - Immunology 2022Quote: ... before amplification using the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... quantified via qPCR (AAVpro Titration Kit version 2; Clontech), and stored at 4°C until use.
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Immunology 2023Quote: ... before whole transcriptome amplification using Advantage 2 Polymerase (Clontech) using oligos that introduce Illumina Nextera Multiplex Identifier (MID ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Microbiology 2021Quote: ... The extracellular SARS-CoV-2 RNA in the culture supernatant was analyzed using SARS-CoV-2 direct detection RT-qPCR kit (RC300A; TaKaRa-Bio, Shiga, Japan). The infectivity of SARS-CoV-2 in the culture supernatants was determined at 48 h post-infection ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Developmental Biology 2021Quote: ... filtered and concentrated by Lenti-X Concentrator (Clontech, PT4421-2) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 20ul mixed concentrations of 2 × ExTaq buffer (Takara, Japan), 0.8ul of each forward and reverse primer (10uM) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 μg of pEGFP-C1 (Takara Bio, Shiga, Japan), together with 0.5 μg of expression plasmid for bcl-xl ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (NbCycB2proE ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (Nbwo-G1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... reactions were performed using the Advantage 2 Polymerase Mix (Clontech) using the primers (Merck ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification was performed using Advantage GC 2 PCR kit (Clontech) and PCR products were cloned and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL of DNA loading buffer (9157, TAKARA, Kusatsu, Japan) was added to the reaction and incubated at 65 ℃ for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... into 96-well plates containing 2 µL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed with 2 × SYBR mix (TaKaRa) in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... fbf-2 cDNA was cloned into the pGBTK vector (Clontech) and transformed into PJ68-4a yeast strain (MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4Δ gal80Δ LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ ...
-
bioRxiv - Immunology 2022Quote: ... NETs were treated with 2 U micrococcal nuclease (Takara Bio) for 10 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and inserted into the pEGFP-C1 vector (Clontech; Fig. 2). The vector-insert construct was propagated in E ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 1x Titanium Taq buffer and 2 μL Titanium Taq (Takara). PCR cycles were ...
-
bioRxiv - Molecular Biology 2024Quote: ... After 2 hrs 1µl of Reverse Transcriptase (PrimeScript RT, Takara) was added and reverse transcription was performed at 420C for 1hr followed by inactivation at 700C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... which corresponds to the S23Q/L24M mutant of SARS-CoV-2 Wuhan-Hu-1 ORF3b *57) was generated by overlap extension PCR by using PrimeSTAR GXL DNA polymerase (Takara), the SARS-CoV-2 ORF3b 155* as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Telomerase-mediated extension and subsequent amplification of TRAP products were conducted in 25-µL reactions containing 1 µL of cell lysate and 2 U of Titanium Taq DNA polymerase (Takara). The other kit components—TRAP reaction buffer ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells were seeded in a 6-well plate at a density of 6 × 105 cells/well and co-transfected with pSIN-siU6 – shSLFN11/ shSLFN12/ shSc (2 μg) along with plasmids pGP (1 μg, Takara) and pPE ampho (1 μg ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... The transformants were grown on SD -Trp plates (Clontech, 2% agar) for selection ...
-
bioRxiv - Developmental Biology 2020Quote: ... Laminin-511 E8 fragment (Takara Bio, #T303, 0.05 – 2 µg/ml) and Laminin-521 (Biolaminin ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was applied to 2 ml Talon Superflow resin (Clontech) pre-equilibrated with buffer A (20 mM Tris/HCl pH 7.5 ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... PCR amplification was done using Advantage HF 2 DNA polymerase (Takara) for 30 cycles according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: The GAL4-based Matchmaker yeast 2-hybrid system (Clontech Laboratories Inc.) was used for yeast-two-hybrid analysis ...
-
bioRxiv - Cancer Biology 2022Quote: U-2 OS Tet-On cells were purchased from Clontech (#630919). MDA-MB-453 cells were purchased from the American Type Culture Collection (ATCC ...