Labshake search
Citations for Takara Bio :
151 - 200 of 2551 citations for 6 CHLORO 2 3 4 9 TETRAHYDRO 1H CARBAZOL 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Microbiology 2023Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C with permanent mixing (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Microbiology 2020Quote: ... thlaspeos tissue was resuspended in 9 ml protoplasting buffer supplemented with 10 mg/ml Yatalase (Takara Bio, Kusatsu, Japan) and 20 mg/ml Glucanex (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: Interactions between CDK-2 and COSA-1 were assayed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech PT4084-1). CDK-2 and COSA-1 cDNAs were amplified from a C ...
-
bioRxiv - Plant Biology 2020Quote: ... The BrSRK-9 CDS fragment was introduced into the KpnI site of pMYC290 by InFusion cloning (TAKARA Bio, Shiga, Japan). Fragments of CDS of the BrSRK S domain and transmembrane domain were amplified by PCR using the first-strand cDNA synthesized from stigma RNA (template ...
-
bioRxiv - Developmental Biology 2021Quote: All novel plasmids constructed for this study were based on the pSP Sox1/2/3> plasmid previously described (9) with the open reading frames replaced by PCR amplifications using a proofreading DNA polymerase (Primestar, Takara) and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... 9, 11, 13, 20, or 45 (SERF2, C9orf16, C19orf53, C11orf58, BEX3, or SERBP1 respectively) was inserted into pCold I (Takara), together with the client protein ...
-
bioRxiv - Plant Biology 2021Quote: ... fragments containing a stop codon were recombined into Gateway-compatible versions of the GAL4 DNA BD vector pGBT-9 and the activation domain vector pGAD424 (Clontech) using L/R-clonase (ThermoFisher) ...
-
bioRxiv - Plant Biology 2022Quote: ... fragments were recombined into GW versions of the GAL4 DNA-binding domain vector pGBT-9 and the activation domain vector pGAD424 (Clontech). Oligonucleotides used for cloning are listed in Supplementary Table S3.
-
bioRxiv - Genomics 2022Quote: ... Npm1/Flt3-ITD/Cas 9 DM murine AML cells were lentivirally-transduced using a Retronectin-transduction protocol (T100A; Takara Bio) with pHKO9 containing guide RNAs complementary to murine BAF complex members (Smarcb1 ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were incubated overnight at 4° C with anti-rabbit tdTomato (1:2000; TaKaRa, Cat# 632543, RRID:AB_2307319), anti-rabbit GFP (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... The extract was incubated for 1 h at 4 °C with Talon resin (Clontech, Mountain View, CA), loaded onto a column ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was performed using One Step SYBR PrimeScript RT-PCR kit (Takara Bio) on a 7900HT real-time system (Applied Biosystems).
-
bioRxiv - Immunology 2021Quote: ... utilizing the PrimeScript™ One-Step RT-PCR kit (Takara Bio, Shiga, Japan). PCR products were then separated and visualized by agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2019Quote: ... One µg of total RNA was reverse-transcribed using PrimeScript RT reagent (TaKaRa) with oligo dT primers ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized using the one-step PrimeScript RT-PCR Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... A One Step SYBR® PrimeScript™ qPCR kit (TaKaRa Bio, Otsu, Japan) was used to synthesize cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2022Quote: ... was performed with one-step Prime script III RT-qPCR mix (Takara, Japan). The viral RNA of NP was detected by 2019-nCoV-N1 probe (Cat#10006770 ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram of total RNA and the PrimeScript RT reagent kit (Takara Bio.) were used to perform the first-strand cDNA synthesis ...
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of cDNA was added to the PCR-reaction premix (Takara Bio) with 10 pM corresponding primer pairs ...
-
bioRxiv - Molecular Biology 2021Quote: ... RT-PCR was carried out using the One Step RNA PCR Kit (TaKaRa Biotechnology Dalian ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes 55 ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Genetics 2023Quote: ... Initially the Matchmaker® Gold Yeast One-Hybrid Library Screening System (Takara Bio) was employed ...
-
bioRxiv - Bioengineering 2024Quote: ... mixed with one-tenth of the volume of Lenti-X Concentrator (Takara Bio), and incubated at 4 °C for 24 h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...