Labshake search
Citations for Takara Bio :
1 - 50 of 778 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Microbiology 2023Quote: ... lytic-induced or uninduced cells (5×105 cells on a 6-well plate) were harvested with 500 μL of RNAiso Plus (Takara Bio). Total RNA was extracted ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... the supernatant was transferred into clean conical tubes and purified by cobalt metal affinity chromatography using approximately 4-6 mL of cobalt resin slurry (Talon Metal Affinity Resin, #635503, Clontech Laboratories, USA) within a gravity-flow column ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 μM 6-mer random primer (Takara), 0.5 mM dNTP mix (Promega ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 6 ml Lenti-X Concentrator (Takara Bio; 631231), mixed thoroughly ...
-
bioRxiv - Immunology 2024Quote: ... 6 wells plate was coated with Retronectin (Takara, 10µg/cm2) for 2h at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... Cell lysates were quantified using the bicinchoninic acid assay (BCA, Takara). For each sample ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Immunology 2024Quote: ... DTT (5 mM, Takara), recombinant RNase inhibitor (1 U/uL ...
-
bioRxiv - Bioengineering 2021Quote: ... we pipetted 6 µL of 1x lysis buffer prepared from Clontech SMART-seq v4 kit with 2 U/µL RNAse inhibitor onto the coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-well plates of 70% confluent Lenti-X 293T cells (Clontech) were transfected with 1.5 μg transfer vector ...
-
bioRxiv - Cell Biology 2024Quote: ... or pCS2-6 × Myc expression vector (Clontech, Mountain View, CA, USA). All plasmids were verified by sequencing.
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...