Labshake search
Citations for Takara Bio :
301 - 350 of 2647 citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The extracellular SARS-CoV-2 RNA in the culture supernatant was analyzed using SARS-CoV-2 direct detection RT-qPCR kit (RC300A; TaKaRa-Bio, Shiga, Japan). The infectivity of SARS-CoV-2 in the culture supernatants was determined at 48 h post-infection ...
-
bioRxiv - Microbiology 2019Quote: ... (5’-GGT CTC TCT GGT TAG ACC AGA TCT GAG C-3’ and 5’-AAA CAT GGG TAT TAC TTC TGG GCT GAA AG-3’) using PrimeSTAR®HS (TAKARA) and purified by QIAquick Gel Extraction (QIAGEN) ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 °C for 45 min and the supernatants incubated with TALON beads (Clontech) pre-equlibrated with purification buffer at RT over night with overhead rotation followed by washing with wash buffer (8M urea ...
-
bioRxiv - Neuroscience 2019Quote: ... and concentrated using ultracentrifugation (26,000rpm/2hrs/4°C) or Lenti-X concentrator (Clontech) before being added to cell cultures ...
-
bioRxiv - Immunology 2021Quote: ... were coated overnight at 4°C with 20 μg/ml Retronectin (Takara T100B). Viral supernatant was spun for 90 minutes at 2,000g and 30°C onto the plated retronectin and half the supernatant volume removed carefully after spinning ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the supernatant was incubated with 4 ml TALON metal affinity resin (Clontech) at 4°C for 1 hr ...
-
bioRxiv - Neuroscience 2024Quote: ... and individual cells were captured in separate wells of a 96-well plate containing 4 μl lysis buffer (1 U/μl RNase inhibitor [Clontech, Cat#: 2313B]), 0.1% Triton (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... filtered and concentrated by Lenti-X Concentrator (Clontech, PT4421-2) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 20ul mixed concentrations of 2 × ExTaq buffer (Takara, Japan), 0.8ul of each forward and reverse primer (10uM) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 μg of pEGFP-C1 (Takara Bio, Shiga, Japan), together with 0.5 μg of expression plasmid for bcl-xl ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (NbCycB2proE ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (Nbwo-G1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... reactions were performed using the Advantage 2 Polymerase Mix (Clontech) using the primers (Merck ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification was performed using Advantage GC 2 PCR kit (Clontech) and PCR products were cloned and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL of DNA loading buffer (9157, TAKARA, Kusatsu, Japan) was added to the reaction and incubated at 65 ℃ for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... into 96-well plates containing 2 µL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed with 2 × SYBR mix (TaKaRa) in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... fbf-2 cDNA was cloned into the pGBTK vector (Clontech) and transformed into PJ68-4a yeast strain (MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4Δ gal80Δ LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ ...
-
bioRxiv - Immunology 2022Quote: ... NETs were treated with 2 U micrococcal nuclease (Takara Bio) for 10 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and inserted into the pEGFP-C1 vector (Clontech; Fig. 2). The vector-insert construct was propagated in E ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 1x Titanium Taq buffer and 2 μL Titanium Taq (Takara). PCR cycles were ...
-
bioRxiv - Molecular Biology 2024Quote: ... After 2 hrs 1µl of Reverse Transcriptase (PrimeScript RT, Takara) was added and reverse transcription was performed at 420C for 1hr followed by inactivation at 700C for 30 mins ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...