Labshake search
Citations for Takara Bio :
1 - 50 of 2502 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Microbiology 2023Quote: ... RT-PCR was performed using 500 ng of RNA in 10 µl volume of Solution with PrimeScript RT (TAKARA) and random hexamer primers ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... HBO can be cryopreserved by using STEM-CELLBANKER GMP grade (TaKaRa Bio).
-
bioRxiv - Developmental Biology 2023Quote: ... The constructed plasmids then were purified using nucleospin plasmid-transfection grade (TAKARA) and transfected into piezo1-deficient N2A cells (Sugisawa et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 0.5 µl aliquot of the resulting genomic DNA solution was used as the template for genotyping purposes in 25 µl PCR reactions with Ex Taq DNA polymerase (TaKaRa, RR001). PCR products were subcloned with the TOPO TA cloning Kit (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... colonies were picked into 96-well plates and a small proportion of cells from each colony were used for DNA extraction using Quick Extract solution (Epicenter) and direct PCR with Prime STAR® GXL DNA Polymerase (Clontech). PCR amplicons were sequenced by Sanger to verify the deletion (SFigure 17).
-
bioRxiv - Cancer Biology 2020Quote: ... The ICELL8® 3’ DE Chip was placed on the ICELL8® MSND and loaded 50 µL of RT-PCR solution (Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... were amplified and purified by Nucleospin plasmid TF grade (Takara bio, Shiga, Japan). All plasmid sequences were verified using Sanger sequencing (3100 Genetic Analyzer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µl/well of beads were washed twice with TE solution and then resuspended in lambda DNA solution (diluted to approximately 20 ng/µL in TE solution, 3010, Takara). Then ...
-
bioRxiv - Genetics 2024Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using SYBR Green PCR Master Mix (Takara) in an Applied Biosystems QuantStudio 3 ...
-
bioRxiv - Microbiology 2021Quote: ... recombined by PCR (TaKaRa PCR kit (Clontech Laboratories)) using the primers and cycle conditions in Table S1C ...
-
bioRxiv - Microbiology 2021Quote: ... recombined by PCR (TaKaRa PCR kit (Clontech Laboratories)) using the primers and cycle conditions in Table S1C ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR (CloneAmp HiFi PCR Premix, Takara-Bio Europe) genotyping was done with primers designed for each knock-out line that allowed for confirming either the presence of the wild-type (F-gt5/R-gt5WT and F-gt3WT/R-gt3 ...
-
bioRxiv - Plant Biology 2023Quote: ... we PCR amplified (CloneAMP HIFI PCR premix, TAKARA) the coding sequences of ATG8a ...
-
bioRxiv - Microbiology 2021Quote: ... in solution and stopped by adding guanidinium thiocyanate solution buffer NTI (Takara Bio). After the methylation reaction following DNA purification ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR reactions containing 1× LA PCR Buffer II (Clontech), 2.5 mM MgCl2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was done using the Terra™ PCR Direct PCR mix (Takara Bio, Kusatsu, Shiga Japan). Genotyping for Lhx2 was performed as described earlier (Mangale et al. ...
-
bioRxiv - Molecular Biology 2020Quote: Primers (PAGE grade, fasmac, Appendix Table S4) were labelled with 32P-γ-ATP by T4PNK (Takara), followed by filtering through MicroSpin G-25 Columns (GE healthcare) ...
-
bioRxiv - Cancer Biology 2023Quote: For indexing PCR, 78μL PCR mix (24μL H20, 50μL 2X SeqAmp CB PCR buffer (Takara Cat. #638526), 2μL SeqAmp DNA polymerase ((Takara Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using SaphireAmp Fast PCR Master Mix (Takara) in 50 μl volume.
-
bioRxiv - Biochemistry 2023Quote: ... All PCR was done with HiFi PCR master mix (Takara) following the manufacturer recommendations.
-
bioRxiv - Microbiology 2022Quote: All plasmid inserts were amplified by PCR using standard PCR conditions and the CloneAmp HiFi PCR premix (Takara). Following a PCR purification step (QIAquick PCR purification kit) ...
-
bioRxiv - Cell Biology 2020Quote: ... nested PCR was performed using PCR Mycoplasma Detection Set (Takara, 6601).
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were performed using CloneAmp™ HiFi PCR Premix (Takara) for 35 cycles with an annealing temperature of 52 °C according to the manufacturer’s suggestions ...
-
bioRxiv - Immunology 2021Quote: ... with the Power PCR TB green PCR master mix (Takara, Japan). 2µl of sample cDNA was used in a total volume of 10µl (3µl primer mix and 5µl of TB green ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was PCR-amplified using Terra PCR Direct Polymerase (Takara Bio). Final libraries were prepared using 1ng of cDNA per library with the Nextera XT kit (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... The PCR was done in PrimeStar GXL PCR reaction (TaKaRa, R050A). The primer sequences are:
-
bioRxiv - Plant Biology 2024Quote: ... All PCR reactions were performed using the PCR components from Takara bio Inc ...
-
bioRxiv - Microbiology 2024Quote: ... PCR DNA amplifications were performed with CloneAmp HiFi PCR premix (Takara) using Primer-AP (5’ GACCACGCGTATCGATGTCGAC 3’ ...
-
bioRxiv - Immunology 2023Quote: ... PCR was performed on a PCR thermal cycler (Takara, Tokyo, Japan) and real-time PCR was performed using QuantStudio 3 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Each PCR reaction was composed of CloneAmp HiFi PCR premix (Takara), 4ng of the plasmid template and 10-20ng of the primer pair mix ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using Sapphire Amp PCR Mastermix (Takara Bio, RR350B). For SftpcCreERT2 ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR amplification was performed using SapphireAmp Fast PCR Master Mix (TAKARA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/μl) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/ml) ...
-
bioRxiv - Microbiology 2021Quote: ... Following hybridization with ExpressHyb solution (Takara) membranes were washed 4 times and visualized by autoradiography ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated with Lenti-X solution (Takara) and concentrated by centrifugation ...
-
bioRxiv - Molecular Biology 2020Quote: Primary RT-PCR and secondary PCR was performed using the Primescript III 1-step RT-PCR kit and EmeraldAmp GT PCR Mix (Takara; detailed protocol provided in Supplementary File 1) ...
-
bioRxiv - Microbiology 2020Quote: ... All elements of the DiCre plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated (In-Fusion HD Cloning Kit, Clontech) into an acceptor plasmid containing a TgDHFR/TS cassette flanked by two LoxP sites ...
-
bioRxiv - Plant Biology 2024Quote: ... The qRT-PCR analysis was performed using the ABI StepOne Plus PCR system and the SYBR Green Realtime PCR mix (Takara). The ubiquitin gene (Lj5g3v2060710 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Immunology 2023Quote: ... The components of the master mix for the PCR and the PCR programs were set up according to the CloneAmp HIFI PCR protocol (Takara). All generated plasmids were sequenced before use (Eurofins Genomics).
-
bioRxiv - Molecular Biology 2020Quote: LNA/DNA probes (PAGE grade, fasmac, Table SX) were labelled with 32P-γ-ATP by means T4PNK (Takara), followed to filter by MicroSpin G-25 Columns (GE healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: ... Real time PCR was done via Real-time PCR equipment TP970 (Takara) and analyzed by Thermal Cycler Dice® Real Time System (Takara).
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Cell Biology 2021Quote: ... open reading frames were PCR-amplified using CloneAmp HiFi PCR Premix (Clontech), gel-purified using the Nucleospin® Gel and PCR Clean-Up kit (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCR was performed with EmeraldAmp MAX PCR Master Mix (Takara). Primers for amlplication of Piezo1 and Gapdh genes were listed in our previous study [26].
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara). Relative expression with respect to control (act2 gene ...