Labshake search
Citations for Takara Bio :
1 - 50 of 503 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 µl anti-c-Myc Monoclonal antibody (Clontech/Takara) were added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 µl anti-c-Myc Monoclonal antibody (Clontech/Takara) were added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Random Primer (nonadeoxyribonucleotide mix: pd(N)9) (TaKaRa) from the total RNA of Ophiocordyceps sp ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9-15 cycles of PCR amplification were performed with Extaq (Takara). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara). The AAV solution was concentrated to the optimal volume (up to 100 μL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and wild type etoll-9 was cloned in pGBKT7-BD vector (Clontech). Each mutant etoll-AD was transformed in Y187 strain followed by selection on synthetic defined (SD ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara, Japan). The AAV solution was concentrated to the optimal volume by centrifugation using an Amicon Ultra-4 100k centrifugal filter unit (Millipore) ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was performed for 8-9 cycles using PrimeSTAR GXL Polymerase (Takara) at an annealing temperature of 60°C ...
-
bioRxiv - Genomics 2022Quote: ... rAAV-9 serotype virons were produced by transfecting AAVpro 293T cell (Takara, 6322723) with pCMV-sadCas9-KRAB (Addgene ...
-
bioRxiv - Bioengineering 2024Quote: ... lentivirus targeting mCherry to the cell membrane (Takara, 0026VCT, rLV.EF1.mCherry-Mem-9) was used according to manufactures recommendation ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara, Siga, Japan). The AAV solution was concentrated to the optimal volume by centrifugation using an Amicon Ultra-4 100k centrifugal filter unit (Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... Six hundred thirty nanograms of total RNA was annealed to random 9-mer primers (TaKaRa) and reverse-transcribed using ProtoScript II (New England Biolabs) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Genomics 2020Quote: ... Each sample was PCR amplified for 9 cycles using HS LA Taq (Takara, Mountain View, CA) and cleaned with 0.7X AMPure beads to remove small fragments and excess reagents (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... H2B-mCherry organoids were infected with LV.EF1.AcGFP1-Mem-9 lentivirus particle (Clontech, Takara Bio USA). For the H2B-miRFP670 line ...
-
bioRxiv - Cell Biology 2022Quote: ... H2B-mCherry organoids were infected with LV.EF1.AcGFP1-Mem-9 lentivirus particle (Clontech, Takara Bio USA). For the H2B-miRFP670 line ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Molecular Biology 2021Quote: ... under high mutation rate conditions (9-16 mutations per kilobase pair) and subcloned into the pN1 vector (Clontech). Obtained gene libraries in expression vectors were electroporated into NEB10-β E.coli host cells (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... which was modified to obtain a CFP reporter cell line (rLV.EF1.AmCyan1-9 [0039VCT] Clontech, Takara Bio Europe). The LX2 cell line was maintained in DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... which was modified to obtain a CFP reporter cell line (rLV.EF1.AmCyan1-9 [0039VCT] Clontech, Takara Bio Europe). The LX2 cell line was maintained in DMEM ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was performed for 8-9 cycles using high-fidelity polymerase (LA-Taq or PrimeSTAR GXL, Takara) at an annealing temperature of 60℃ ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... High-quality RNA (10 ng, RIN>9) was used to produce cDNA libraries using SmartSeq v4 (Clontech, 634888). cDNA was prepared into sequencing libraries using 150 pg of full-length cDNA amplicons with the Illumina® Nextera XT DNA Library Preparation Kit with dual index barcodes ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Microbiology 2020Quote: ... thlaspeos tissue was resuspended in 9 ml protoplasting buffer supplemented with 10 mg/ml Yatalase (Takara Bio, Kusatsu, Japan) and 20 mg/ml Glucanex (Sigma-Aldrich ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Plant Biology 2020Quote: ... The BrSRK-9 CDS fragment was introduced into the KpnI site of pMYC290 by InFusion cloning (TAKARA Bio, Shiga, Japan). Fragments of CDS of the BrSRK S domain and transmembrane domain were amplified by PCR using the first-strand cDNA synthesized from stigma RNA (template ...
-
bioRxiv - Developmental Biology 2021Quote: All novel plasmids constructed for this study were based on the pSP Sox1/2/3> plasmid previously described (9) with the open reading frames replaced by PCR amplifications using a proofreading DNA polymerase (Primestar, Takara) and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... 9, 11, 13, 20, or 45 (SERF2, C9orf16, C19orf53, C11orf58, BEX3, or SERBP1 respectively) was inserted into pCold I (Takara), together with the client protein ...
-
bioRxiv - Plant Biology 2021Quote: ... fragments containing a stop codon were recombined into Gateway-compatible versions of the GAL4 DNA BD vector pGBT-9 and the activation domain vector pGAD424 (Clontech) using L/R-clonase (ThermoFisher) ...
-
bioRxiv - Plant Biology 2022Quote: ... fragments were recombined into GW versions of the GAL4 DNA-binding domain vector pGBT-9 and the activation domain vector pGAD424 (Clontech). Oligonucleotides used for cloning are listed in Supplementary Table S3.
-
bioRxiv - Genomics 2022Quote: ... Npm1/Flt3-ITD/Cas 9 DM murine AML cells were lentivirally-transduced using a Retronectin-transduction protocol (T100A; Takara Bio) with pHKO9 containing guide RNAs complementary to murine BAF complex members (Smarcb1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Confluent HEK293 cells were transfected using a mixture of 50 μl of Opti-MEM I containing a total of 0.9 μg of cDNA constructs encoding hGluN1/hGluN2 subunits and GFP (for identification of successfully transfected cells; pQBI 25, Takara) in a 1:1:1 ratio ...