Labshake search
Citations for Takara Bio :
1 - 50 of 1047 citations for 3 Bromo 4 8 dichloro 5 methoxyquinoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-caccgccatggtggcggatcccttgtacagctcgtccatgcc −3’) (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-cacgtctcatcccctccatctttgacctttcaaagtg - 3’) (Clontech). The full-length Tenm4 cDNA ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ and 3’-ends of RBK21 cDNA were analyzed using 5’-Full and 3’-Full RACE core sets (TAKARA) with specific primers (Extended Data Table 8) ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length of itga2 was inserted into the Sfi IA (5′-GGCCATTACGGCC-3′) and Sfi IB (3′-GGCCGCCTCGGCC-5′) sites of the “prey” pPR3-C vector (Clontech). Series of combinations of bait and prey constructs were cotransformed into the yeast strain NMY51 (Clontech) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Biochemistry 2024Quote: ... for A3>P: 5’-aaaacacugaaccug-3’ for A2>P: 5’-aaacacugaaccug-3’) were incubated with 10 U recombinant MazF (Takara Bio) in 20 mM Tris pH 8.0 ...
-
bioRxiv - Genetics 2024Quote: ... The 4–11 kb fragments of the DFR-B sequence were amplified by PCR using the primers DP-LF (5′-TTAACATGAGGGGATTGCATGTCACTTTCA-3′) and D3U-LR (5′-CATAAATCTGGTTCGAGTGGCAATCTAACT-3′) with Ex-Premier DNA Polymerase (TAKARA, Japan). The PCR conditions were as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...