Labshake search
Citations for Takara Bio :
1 - 50 of 689 citations for 3 Acetoxy 8 17 13E Labdadien 15 Oic Acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µL of ligation mix were transformed into 15 µL Stellar Competent cells (Takara 636763) and plated on AMP LB selection plates followed by overnight incubation at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Day 17 embrionic RNA was used to validate primers (Clontech/Takara). cDNA was synthesised with Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Day 17 embrionic RNA was used to validate primers (Clontech/Takara). cDNA was synthesised with Superscript III (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP (JL-8, Clontech) or Vinculin (7F9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and purified cDNA was eluted in 17 µL elution buffer provided by Clontech. All samples were quantitated using Bioanalyzer 2100 Instruments (Agilent Genomics) ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified cDNA was eluted in 17 μl elution buffer provided by Takara. All samples were quantitated using PicoGreen® on Molecular Dynamics M2 SpectraMax instrument ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP (JL-8, Clontech, #632381). Secondary antibodies used included ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Cancer Biology 2023Quote: ... GFP (632381,JL-8, Takara), p-VASP (3111 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 µl Cloning Enhancer (Takara) was added to 20 µl of the PCR product and incubated for 15 min at 37 °C on a thermocycler ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Neuroscience 2024Quote: ... GFP (1:1,000, JL-8, Clontech), GABARAP/Atg8a (1:2,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... Living Colors (GFP) (JL-8, 632380, Clontech), α-Tubulin (DM1A ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP clone JL-8 (Takara 632381) 0.5 µg/mL ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Cell Biology 2023Quote: ... mAb clone JL-8 (632381) from Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Clone JL-8; Clontech) at 1:1,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... mAb clone JL-8 (632381) from Takara Bio.
-
bioRxiv - Cell Biology 2024Quote: ... and anti-GFP antibody (JL-8, Clontech).
-
bioRxiv - Microbiology 2021Quote: ... using 15 μl of elution buffer (Takara). Library quantification was performed with a Qubit 3 Fluorometer with dsDNA Hs Assay kit (Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-GFP (JL-8 clone, Takara Bio) or mouse anti-alpha-tubulin (Sigma) ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-GFP monoclonal antibody JL-8 (632381, Clontech) was used at 1/3000 ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... GFP tag (JL-8 monoclonal antibody from Takara), and mCherry (polyclonal antibody from Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Microbiology 2023Quote: ... HEK-293/17 cell media were harvested and concentrated overnight with a Lenti-X concentrator (Clontech, Mountain View, CA) according to the manufacturer’s protocol and resuspended in 10-fold less media volume prior to concentration.
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-GFP JL-8 (1:1000, Clontech 632380), polyclonal rabbit anti-RP2 (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal anti-GFP (Living Colors JL-8, Clontech), or a monoclonal anti-β-actin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-GFP JL-8 (cat. no. 632381, Takara) used at a concentration of 1:2,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Protamine sulfate (Final concentration: 8 μg/ml, Takara Bio) was added ...