Labshake search
Citations for Takara Bio :
1 - 50 of 455 citations for 10 PROPOXY DECANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biophysics 2019Quote: ... D40A mutation and deletion of C-terminal 10 amino acids were introduced into pET15-sfGFP-minD by using the PrimeSTAR Max mutagenesis protocol (TaKaRa, Shiga, Japan). Similarly ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... 10 µl of 10 mM dNTPs (Clontech #639125), 2.5 µl RNase Inhibitor (Lucigen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 10% glycerol) containing DNase I (10 U, Takara) and incubated at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 mM maleic acid buffer pH 5.5) containing 100 mg Yatalase (Takara) and 100 mg Lysing Enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Biophysics 2021Quote: ... 10% FBS (Clontech), 50 U/mL penicillin ...
-
bioRxiv - Cell Biology 2020Quote: ... target proteins were purified from cell lysate by Ni-iminodiacetic acid affinity chromatography (Clontech). However ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration was determined by bicinchoninic acid assay using bovine serum albumin (TaKaRa Bio) as the reference standard ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 10% FBS (TaKaRa, 631106). HCT116 OsTIR1 cells (kindly provided by Masato Kanemaki ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% FBS (Clontech), 100 units/mL penicillin ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 10 % FBS (Clontech), penicillin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 μL PCR mixture (TaKaRa), 1 μL upstream primer (10 μmol/L) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 10% FBS (Clontech) in a humidified atmosphere of 5% CO2 at 37°C.
-
bioRxiv - Systems Biology 2021Quote: ... supplemented with 10% FBS (Clontech), GlutaMAX supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... supplemented with 10% FBS (Clontech), 100 units/mL penicillin ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 10% FBS (Takara), 1% NEAA (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% FBS (Clontech) and 2 mM L-glutamine (PAN Biotech ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of Mixture (TaKaRa, Japan), 1 μL upstream primers (10 μmol/L ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μL of Clone AMP (Takara), and 300 nM each of primers ks1 and mf83 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 U μl–1 SMARTScribe (Clontech) and 10 U μl–1 RNASin plus (Promega) ...
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: ... 10% Tet system approved FBS (Takara), 100 units/ml penicillin and 100 μg/ml streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 10% Fetal Bovine Serum (Clontech). Cells were grown at 37°C with 5% CO2 and passaged using 0.05% Trypsin-EDTA solution (Thermo Fisher ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 10% Tet Approved FBS (Clontech Laboratories), and 1X Penicillin/Streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... 10-15 µg of EGFP (Clontech) was coated onto 6-8 mg of 1.6 µm gold beads.
-
bioRxiv - Plant Biology 2022Quote: ... using 10 pmol random nonamers (Takara) in 20 μl reaction volume and according to manufacturers’ instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 10% FBS (Takara Bio, 631368) and 1x penicillin-streptomycin in 24-well glass-bottomed No ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Synthetic Biology 2024Quote: ... supplemented with 10% FBS (Takara 632180). LentiX cells (Takara 632180 ...
-
bioRxiv - Molecular Biology 2021Quote: ... DMEM supplemented with 10% fetal bovine serum (FBS) and 10 μl DNase I (Takara Bio, Shiga, Japan) was then added to the samples and incubated for 5 min at room temperature (RT) ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Genomics 2020Quote: ... and 10 μL PCR Mixture (TaKaRa, Japan). PCR reaction was conducted on a T100 thermocycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 10% Fetal Bovine Serum (FBS, Takara) and 100 U/mL penicillin/streptavidin (pen/strep ...
-
bioRxiv - Genomics 2019Quote: ... 10 U/ml DNase I (TaKaRa 2270A) was added to the reaction after 3-min digestion and gently pipetting was repeated every 5-6 min digestion ...