Labshake search
Citations for Takara Bio :
1 - 50 of 1809 citations for 1 Ethylbenz cd indol 2 1H ylidene malononitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and 3′-RACE CDS primer (ClonTech) for cDNA synthesis from 5,4 μL uf viral RNA ...
-
bioRxiv - Immunology 2024Quote: ... and 3′-RACE CDS primer (Clontech). Next ...
-
bioRxiv - Plant Biology 2020Quote: ... The PuERF2 CDS was cloned into the pRI101 vector (TakaRa) to allow expression of PuERF2 as a fusion with green fluorescent protein (GFP ...
-
bioRxiv - Developmental Biology 2020Quote: ... SlPP2C3 (Solyc06g076400.2.1) CDS was cloned into pRI101-AN plasmid (TAKARA). For SlPP2C3-RNAi tomato transformation ...
-
bioRxiv - Plant Biology 2023Quote: ... The full-length and truncate CDS of TaNAM-A1a (residues 1–220) were cloned into bait vector pGBKT7 (Clontech) respectively to generate bait plasmids BD-NAM-A1full and BD-NAM-A11-220 ...
-
bioRxiv - Cancer Biology 2020Quote: ... TRIP12 CDS was subcloned into the LHCX vector (Clontech, Cat. No. 631511) using a single NotI site introduced into the LHCX vector through the HindIII site.
-
bioRxiv - Neuroscience 2021Quote: ... 1% normal donkey serum) for 1h at room temperature followed by incubation in primary antibodies (rabbit anti Ds-red, Takara, cat# 632496 ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Developmental Biology 2021Quote: ... NKX2.1 CDS harbouring each mutation was amplified and inserted by Infusion (638909, Takara) cloning into the tetON-NKX2.1/EF1a-TagRFP-2A-tet3G Dox-inducible lentiviral vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... the target mRNA CDS sequence was cloned using PrimeSTAR® Max (TAKARA, R045) or Q5® High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... the CDS of TaNAC016-3A were fused into the yeast vector pGADT7 (Clontech) to generate AD-NAC016-3A prey plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... MB CDS were ligated in XhoI and BamHI digested pmCherry-C1 (Takara Bio #632524) or in HindIII and BamHI digested pmCherry-N1 (Takara Bio #632523 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CDs of cdon was amplified using PCR (Prim STAR Max Premix Takara NO.R045A) and cloned into the vector PCS2+ to generate the expression constructs (5x In-Fusion HD Enzyme Premix ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS of effectors were cloned into pGBKT-7 vector (Clontech, USA, PT3248-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Plant Biology 2020Quote: All SUMO CDS were translationally fused with the activation domain of pGADT7 AD (Takara Bio). βC1 was fused with binding domain and cloned into pGBKT7 BD (Takara Bio) ...
-
bioRxiv - Plant Biology 2022Quote: ... we fused proAtSPCH and MpSETA CDS fragments by PCR using PrimeSTAR GXL polymerase (Takara Bio). The resultant PCR fragment was subcloned into pENTR1A entry clones (Invitrogen ...
-
bioRxiv - Synthetic Biology 2020Quote: ... including the promoter and the full CDS was amplified by high-fidelity PCR (TaKaRa Bio) and sequenced on an Illumina MiSeq system with transposase based library preparation kit (Nextera XT ...
-
bioRxiv - Plant Biology 2020Quote: ... the CDS of ONAC127 and ONAC129 was cloned into the pGBKT7 and pGADT7 vector (Clontech). The fusion plasmids were then transformed into yeast strain AH109 or Y187 ...
-
bioRxiv - Evolutionary Biology 2022Quote: CDS sequence coding protein BmMETTL3(204-329) was cloned into the Pcold vector (TaKaRa, China). Primers were listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: The coding sequence (CDS) of SAUR30 was cloned using Prime STAR MAX polymerase mix (TaKaRa) and the gene-specific primers shown in Supplemental Table S1 ...
-
bioRxiv - Microbiology 2024Quote: ... CDS cDNA was then used as template for PCR with HiFi PCR mix (Takara Bio) to make each ORF compatible for In-Fusion cloning (Takara Bio) ...
-
bioRxiv - Plant Biology 2020Quote: ... Full-length CDS of FveIAA4 and FveGID1c were ligated into GAL4 BD vector PBGK T7 (Clontech Inc.) through EcoRI/SalI double digestion sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CDs of amd1 and skp2 were amplified individually using PCR (Prim STAR Max Premix Takara, R045A) and cloned into the PCS2+ vector (5x In-Fusion HD Enzemy Premix ...
-
bioRxiv - Plant Biology 2021Quote: ... The full-length CDS features of those genes were amplified by PrimeSTAR Max DNA Polymerase (Takara Bio, Japan) with each primer set and cloned into the BamHI and Hind III sites of the pCold I vector by In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Plant Biology 2024Quote: ... The full length of KHRB1 CDS was amplified with adapter-included primers (Table S5) and PrimeSTAR GXL (TaKaRa) to be subcloned into pENTR vector (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa, Japan) according to manufacturer’s directions with an annealing temperature of 56.4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... The BrSRK-9 CDS fragment was introduced into the KpnI site of pMYC290 by InFusion cloning (TAKARA Bio, Shiga, Japan). Fragments of CDS of the BrSRK S domain and transmembrane domain were amplified by PCR using the first-strand cDNA synthesized from stigma RNA (template ...
-
bioRxiv - Cell Biology 2021Quote: ... BicD and GFP CDS were amplified by PCR and the two fragments were combined into AttB-pUASp-K10 vector by InFusion cloning (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... All PIF3 constructs for the yeast transactivation assays were generated by subcloning either the full-length or a fragment of PIF3 CDS into the EcoRI/SalI sites of the pBridge vector (Clontech). The GST-PIF3 and GST-PIF3mTAD constructs for GST pulldown assays were generated by subcloning PIF3 or PIF3mTAD into the EcoRI/XhoI sites of the pET42b vector (Promega) ...
-
bioRxiv - Plant Biology 2021Quote: ... the CDS of SWEET5 was amplified by primers P17 and P18 and subcloned into it by In-Fusion® (Takara). The agroinfiltration-based assays were performed as previously described (Gookin and Assmann ...
-
bioRxiv - Plant Biology 2023Quote: ... and was cloned into the AscI site of the pENTR/D-TOPO entry vector containing full length MpNEK1 CDS (Otani et al., 2018) by In-fusion system (Takara). The resulting vector pENTR/D-TOPO-MpNEK1-mCitrine was subjected to LR reaction to transfer MpNEK1-Citrine fusion into the Gateway binary vector pMpGWB144 (MpEF1α pro:XVE >>LexA operator:Gateway cassette).
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... was digested with NheI and KpnI and the Lmx1a CDS and IRES-GFP fragments were inserted using the In-Fusion HD Cloning kit (Takara). Molecular biology kits used are listed in Table T4.
-
bioRxiv - Neuroscience 2021Quote: ... three types of the GPR151 CDS-related inserts were sub-cloned into FUGW vector using In-Fusion Cloning kit (Takara, 638910). For control experimental sets ...
-
bioRxiv - Neuroscience 2022Quote: ... was digested using HinDIII and XhoI to remove the PSMD2 CDS and the amplified Zic3 gene was cloned using Infusion kit (Clontech, USA) as per manufacturer’s instruction. ...
-
bioRxiv - Plant Biology 2022Quote: ... StNPR1 or StNPR3/4 cds) construct combinations were transformed into the Y2H Gold strain using the Matchmaker Gold Yeast Two-Hybrid System (Clontech, USA) and the transformants selected on control SD media without Leu and Trp (-L-W) ...
-
bioRxiv - Immunology 2024Quote: ... hTRIM21 full-length CDS with N-terminal Myc and EGFP was cloned into pLEX-MCS and transfected into HEK293T-Lenti cells (Clontech 632180) along with pMD.2G and psPAX2 (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: ... The coding sequences (CDS) of the full length and truncated Sr62NLR were cloned into pGADT-7 vector (Clontech, USA, PT3249-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-E-Cad 1:200 (M108, clone ECCD-2, TaKaRa), anti-Nanog 1:200 (eBIO-MLC51) ...
-
bioRxiv - Plant Biology 2024Quote: The full-length coding sequences (CDS) of NPR1 and TGA were fused to the bait vector pGBKT7 (Clontech, Palo Alto, CA, USA) by NdeI (Thermo Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Silent mutations were introduced to the region (CDS 2965 nt-2985 nt, 989-995 residues) (CAG-GAGCTGTCCGAAACTGAA→CAAGAACTTAGCGAGACAGAG) by Infusion cloning (Takara Bio Inc) to make the construct resistant to the UAS-Klp61F-RNAi #1 line (TRiP.GL00441 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... single GFP+ cells were captured into 96-well plate with 11.5 μl lysis buffer and RNase Inhibitor without the CDS IIA Oligo (Takara Bio, Mountain View, CA), and stored at −80°C until used for construction of cDNA libraries ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Pathology 2024Quote: ... ENTV-1 and ENTV-2 were amplified by PCR (Table 2) using the high-fidelity DNA polymerase “PrimeStar GXL” (Takara), with primers targeting exogenous β-retroviruses ...
-
bioRxiv - Genomics 2020Quote: ... RNase Inhibitor (0.4 U) and 1.92 μM of the 3’ oligo dT terminating primer: SMART-Seq® ICELL8® CDS (Takara Bio USA, CA, USA).
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...