Labshake search
Citations for Takara Bio :
401 - 450 of 3028 citations for RNA Binding Motif Protein 45 RBM45 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... or anti-GFP antibody (Clontech) for 1 hour at room temperature followed by a second incubation with HRP-conjugated secondary antibody (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Physiology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
Nulliparity affects the expression of a limited number of genes and pathways in Day 8 equine embryosbioRxiv - Developmental Biology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA Sequencing libraries were prepared with SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA extraction from NSC cultures for qRT-PCR and RNAseq analysis was done using NucleoSpin® RNA (Takara) and Trizol (Thermofisher ...
-
bioRxiv - Cell Biology 2020Quote: RNA libraries from the bulk tissues were prepared using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, 634888), with a 15 PCR cycles for the amplification step ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting input and neuronal IP samples were used for isolation of total RNA using Nucleospin RNA XS kit according to manufacturer’s protocol (Takara).
-
bioRxiv - Neuroscience 2020Quote: Total RNA extraction from OL cultures for qRT-PCR and RNAseq analysis was done using NucleoSpin® RNA (Takara) and Trizol (Thermofisher ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were harvested for RNA extraction using RNeasy Plus Mini Kit (Qiagene) or NucleoSpin RNA Plus Kit (Takara). RNA concentration was measured by nanodrop and 500ng to 1000ng total RNAs were used for reverse transcription in 10 ul reaction volume by High-Capacity RNA-to-cDNA kit (ThermoFisher) ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were transfected with given plasmids and then harvested for RNA extraction by NucleoSpin RNA Plus Kit (Takara) 48 hour after transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA-seq library was prepared with SMARTer® Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara), and sequencing was performed in the Next Generation Sequencing platform using NextSeq500 (Illumina) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the samples using a NucleoSpin® RNA Plant kit (Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Total RNA libraries were prepared by using SMART-Seq v4 Ultra® Low Input RNA Kit for Sequencing (Clontech) and analyzed by Illumina HiSeq 2500 system (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... RNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Clontech/Takara). The input quantity of total RNA was comprised between 1 and 22ng ...
-
bioRxiv - Immunology 2021Quote: ... RNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Clontech/Takara). The input quantity of total RNA was comprised between 1 and 22ng ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcribed RNA from sorted cells was generated by SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio). Real-time PCR was performed using a Fast SYBR green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: cDNAs were generated from isolated RNAs using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2020Quote: cDNAs were generated from isolated RNAs using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Isolated RNA was used as input for SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara Bio) and PCR amplification performed ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Library preparation was performed using the ClonTech SMARTer Stranded RNA-SEq Kit V2 for mammalian pico RNA input (Takara) and RNA sequencing was performed using HiSeq 2500 sequencer with 50bp read lengths (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... purified RNA samples were converted to cDNA using the SMART-seq v4 Ultra Low Input RNA Kit (Takara Bio), and cDNA libraries were generated with the Nextera XT DNA Library Preparation Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA-seq libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara, 634412). Libraries were sequenced on the Illumina MiSeq platform ...
-
bioRxiv - Neuroscience 2022Quote: ... and a subset (approximately 75,000 cells) was pelleted prior to RNA extraction using the NucleoSpin RNA Plus XS kit (Takara) following manufacturer protocol ...
-
bioRxiv - Genetics 2023Quote: ... RNA amplification was performed using the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (TaKaRa) and cDNA libraries were prepared using Nextera XT DNA Sample Preparation Kit (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... Reverse transcription was performed with 10 ng RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of total RNA was reverse transcribed using the double primed RNA to cDNA EcoDry premix (Takara Bio). Primers were designed targeting FLuc ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... Full length cDNAs were generated from 350 to 1,000 pg of total RNA using Clontech SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Takara Bio Europe ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then lifted using TrypLE and total RNA was extracted using the Takara RNA plus kit following manufacturer’s instructions (Takara). 5 µL of total mRNA was converted to total cDNA using random hexamers following manufacturer’s instructions (Verso ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNAs from the H1 and H2 hybridomas were purified using the NucleoSpin RNA purification kit (TAKARA, Tokyo, Japan) as described in the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was collected using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (TaKaRa, Cat# 3732) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA Sequencing libraries were prepared with SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was collected using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (TaKaRa, Cat# 3732). GAPDH and vRNA levels were measured with a RT-qPCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the remaining RNA isolation was done using the NucleoSpin RNA II Kit (Clontech Laboratories, Palo Alto, CA; 740955.50). 1 μg RNA was transferred into the cDNA Ecodry Premix Kit prior to the quantitative PCR program being run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated from cells or tumors using a Mini BEST Universal RNA Extraction Kit (Takara, Shiga, Japan). cDNA was prepared from total RNA by reverse transcription using oligo-dT primers (Takara) ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of protein were incubated with TALON beads (Clontech) pre-equilibrated with purification buffer at RT for 1.5 h with overhead rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... the proteins were purified by TALON Metal Affinity Resin (Clontech) and filtered with Amicon Ultra 0.5ml (30K ...
-
bioRxiv - Synthetic Biology 2021Quote: ... concentrated proteins were determined those concentrations with Bradford (Takara Bio) or BCA (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The solubilized protein was purified by Talon-resin (Clontech/Takara) using the hexa-histidine-tag fused at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2020Quote: ... The solubilized protein was purified by Talon-resin (Clontech/Takara) using the hexa-histidine-tag fused at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was purified on a His60 Ni Superflow column (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... which encodes the chaperone protein tag (TaKaRa Bio, Shiga, Japan), following the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cyan fluorescent protein (CFP) expression plasmid was pECFP-C1 (Clontech). Plasmids pCAGGS-CD4-Myc (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... and tdTomato fluorescent protein using in-Fusion cloning (Takara Bio). The 5-plasmid system includes a packaging vector (pHAGE-H2B-NanoLuc-T2A-tdTomato) ...
-
bioRxiv - Biochemistry 2023Quote: ... protein complexes were purified from by Ni2+-NTA (Takara Bio) affinity chromatography (Dsl1:Qb:Qc and His7-Tip20:Sec20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... sfGFP-tagged proteins were visualized with monoclonal anti-GFP (Takara). Anti-Sty1 polyclonal antibody (Jara et al ...