Labshake search
Citations for Takara Bio :
401 - 450 of 989 citations for Mouse Anti Hepatitis E Virus Capsid ORF2 Antibody BD6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Three days post transduction virus-containing supernatants were harvested and concentrated approximately 40-fold using Lenti-X Concentrator (Clontech; Mountainview, CA). Concentrated viruses were frozen and stored at −80°C until needed ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from the cells reserved from compound treatment and virus infection experiments using RNAiso Plus reagent (TaKaRa, Japan) to analyze gene expression by quantitative PCR ...
-
bioRxiv - Immunology 2022Quote: ... Retroviral vectors were packaged into VSV G–pseudotyped murine leukemia virus (MLV) particles by co-transfecting GP2-293 cells (Clontech Laboratories) with pQCXIP constructs and pVSV-G (Clontech Laboratories) ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Microbiology 2023Quote: ... A parallel virus production was obtained by substitution of the ISG20 coding viral genome with pRetroX-Tet-On (Clontech, cat. 632104) that codes for the TetOn protein and allows for dox ...
-
bioRxiv - Neuroscience 2019Quote: Sections were immunolabeled using an anti-DsRed antibody that detects the protein product generated by the recombined R26tdTomato reporter allele (anti-dsRed Ab from Clontech, Catalog (Cat) #632496 ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... western blot and immuno-detection using monoclonal antibodies raised in mouse against the GAL4 activation or binding domain (1:10000 dilution, Clontech, www.clontech.com) following the Matchmaker Monoclonal Antibodies User Manuel from Clontech ...
-
bioRxiv - Cell Biology 2020Quote: ... then stained with the following primary antibodies at 4C overnight (16h): rabbit anti-dsRed (Clontech) 1:1,000 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody used for western blotting (WB) was anti-GFP (Clontech #632592, dilution 1:1000). Secondary conjugated antibodies used for western blotting were Beta Actin HRP conjugated antibody (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... rDA1m was immunostained using a rabbit anti-RFP antibody (1:1000, Takara, cat. number 632496) followed by a Cy3-conjugated donkey anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1%BSA and 10% FBS.Cells were incubated with anti-c-Myc antibody (Clontech Laboratories, USA) at a 1:10 dilution for 16 hr at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Neuroscience 2021Quote: ... After the immortalization procedure the absence of virus was verified using the Lenti-X p24 Rapid Titer Kit (Takara Bio USA, #632200).
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Neuroscience 2021Quote: ... MYC (mouse, Clontech, 631206 ...
-
bioRxiv - Neuroscience 2023Quote: ... the samples were incubated in primary antibody (chicken anti-GFP, Abcam #13970, 1:2000, rabbit anti-DsRed, Takara Bio Clontech #632496, 1:200) for 24 – 48 hours in the dark while shaking at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... the samples were incubated in primary antibody (chicken anti-GFP, Abcam #13970, 1:2000, rabbit anti-DsRed, Takara Bio Clontech #632496, 1:200) for 24 – 48 hours in the dark while shaking at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... A 5 µl aliquot was removed from each sample for immunoblots using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Cell Biology 2022Quote: ... 5um sections from paraffin blocks were used for immunofluorescence staining with the following primary antibodies: tdTomato (dsRed Mouse: Takara Biosystems 632392, Rabbit: Takara Biosystems 632496), GFP (Abcam 6673) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Biophysics 2022Quote: ... containing virus was collected after 48 hrs and concentrated by 50-fold following the protocol of Lenti-X™ Concentrator (Takara, Cat. #: 631232). The concentrated virus in 40uL volume was added to HEK293T cells plated several hours ahead started with 80,000 cells in one well of a 24-well plate ...
-
bioRxiv - Bioengineering 2023Quote: ... CCR5-KO donor rAAV6 virus was produced in HEK-293T cells and was purified with AAVpro Purification Kit (TakaRa, San Jose, CA, USA). Electroporation of the RNP complex was performed using the Lonza 4D-Nucleofector (Lonza Group Ltd ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of PHOT1-citrine was done using Living Colors anti-GFP antibody JL-8 (632381, Clontech), 1:4000 in PBS 5% milk 0,1% tween (PBSTM) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2016) using anti-GFP (Living Colors A.v. peptide antibody, rabbit polyclonal, 1 mg/ml; TakaraBio/Clontech) primary antibody and horseradish peroxidase linked anti-rabbit IgG (from donkey ...
-
bioRxiv - Genetics 2020Quote: ... which were probed sequentially with rabbit Clontech Living Colors Full Length Anti-GFP antibodies (Takara Bio) and goat 680 anti-rabbit IgG antibodies (LiCor) ...
-
bioRxiv - Neuroscience 2022Quote: ... then incubated overnight with the primary antibody rabbit anti-dsRed (1:1000 in PBST; Clontech, AB_10013483) at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were added to the blocking solution (Rabbit anti-DsRed 1:1000, stock #632496, Takara Bio ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Physiology 2023Quote: ... Slides were incubated for 18 hours at room temperature in anti-dsRed antibody (TaKaRa, 1:2000) in 0.1M PB containing 0.3% Triton X-100 and 1% donkey serum ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell and tissue were stained with the following primary antibody: rabbit anti-ZsGreen (1:500; Takara), rabbit anti-NeuN (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... For immunostaining the slides were incubated with primary antibodies anti-DsRed (Takara Bio, #632496, 1/1000), anti-Pax7 (purified hybridoma ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used for staining: anti-FOXG1 (rabbit, Takara, M227, 1:400 dilution), anti-TCF7L2 (rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Plant Biology 2020Quote: ... Membrane blocking was performed with 3%BSA in PBS-t buffer for 1 h at room temperature followed by incubation with Mouse-anti-GFP (TaKaRa) (1/5,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus particles were collected 24 hours and 48 hours after transfection and concentrated with Lenti-X™ Concentrator (Takara, California, USA, Cat#631232). The pellets were then resuspended with PBS ...
-
bioRxiv - Developmental Biology 2019Quote: The following primary antibodies and dilutions were used in this study: rabbit anti-DsRed (Clontech; 1:1000), Goat anti-Sox10 (Santa Cruz ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were incubated with a diluted primary antibody: rabbit polyclonal anti-DsRed at 1:1000 dilution (Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were incubated with rabbit anti-DsRed antibody (1:1,000; #632496, Takara Bio., Mountain View, CA) at room temperature overnight ...
-
bioRxiv - Synthetic Biology 2022Quote: ... After removal of the blocking solution 100 μL of anti-GFP (Living Colors GFP monoclonal antibody, Clontech) diluted 1:10,000 in antibody solution (1x PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...