Labshake search
Citations for Takara Bio :
401 - 450 of 2176 citations for 6 oxo 1 phenyl 1 4 5 6 tetrahydro pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The plug was equilibrated twice in 1 mL of 1× M buffer (TaKaRa) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cell Biology 2024Quote: ... (1:1000 anti GAPDH) (1:1000 anti-TdTomato rabbit primary antibody #632496 from Takara).
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-tdTomato (1:500, Clontech), anti-MAP2 (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-N1 (Clontech #6085-1); GFP-ERcyt ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 unit/μl reaction (Clontech). After incubation with PI (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... pN1-EGFP (Clontech, 6085-1) was used for cell visualisation.
-
bioRxiv - Neuroscience 2020Quote: ... pN1-EGFP (Clontech, 6085-1) was used for cell visualisation.
-
bioRxiv - Neuroscience 2021Quote: ... and mCherry (1:200, Takara Bio USA Inc./Clontech Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... α-dsRed (1:300, Takara, 632392), α-γ-tubulin (1:300 ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... and STEM121 (1:100, Takara) antibodies were used for detecting human cells ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:200), anti-F-actin (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:10000), anti-actin (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... pEGFP-N1 (Clontech, 6085-1). Antibodies include ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM dNTPs (Clontech, #639125), 1 U/μL Rnase Inhibitor (Lucigen ...
-
bioRxiv - Genomics 2021Quote: ... 1×GC buffer ? (Takara, 9155) for 30 PCR cycles ...
-
bioRxiv - Physiology 2022Quote: ... and mCherry (1:500, Takara). Alexa Fluor-conjugated secondary antibodies were used at 1:500 (Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-DsRed (1:500, Clontech), anti-Synapsin I (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... resuspended in CELLBANKER 1 (Takara), and stored at -80°C ...
-
bioRxiv - Neuroscience 2023Quote: ... FOXG1 (rabbit, 1:200, Takara), FOXP2 (goat ...
-
bioRxiv - Physiology 2023Quote: The WST-1 assay (Takara) was performed on HepG2 cells and Huh7 cells to assess the cellular cytotoxicity of Tecomella undulata ...
-
bioRxiv - Bioengineering 2023Quote: ... Stem101 (Takara Y40400; 1:100), Stem121 (Takara Y40410 ...
-
bioRxiv - Bioengineering 2023Quote: ... Stem121 (Takara Y40410; 1:1000), and Stem123 (Takara Y40420 ...
-
bioRxiv - Physiology 2024Quote: ... and mCherry (1:500, Takara). Secondary antibodies from Invitrogen (Alexa Fluor 647 goat anti-rabbit ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (for immunohistochemistry 1:1000, Molecular Probes; for Western blotting: 1:10000, Clontech), mouse anti-Tubulin (1:80 ...
-
bioRxiv - Neuroscience 2020Quote: ... Single labeling involved exposure of sections to 1:25,000 or 1:100,000 anti-DSRed (Takara), 1:500 anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2022Quote: ... Immunofluorescent staining was performed using primary antibodies (FOS, #2250, Cell Signaling Technology, 1:1000; GFP, GFP1020, Aves Laboratories, 1:1000; dsRed, 632496, Takara, 1:1000), antibodies were reacted with species-specific Alexa Fluor-488 ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: anti-GFP (chick 1:20) and anti-DsRed (rabbit, 1:50, Takara Bio#632496). Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Genomics 2019Quote: ... the beads were washed twice with 50 μl 80% freshly-prepared EtOH on the magnetic stand and the dried beads pellets were resuspended in 4 μL elution buffer (RNAse inhibitor 1/200 Takara, CDS primer 0.5 μL in RNAse free water) immediately followed by an incubation at 72°C for 3 min ...