Labshake search
Citations for Takara Bio :
401 - 450 of 1542 citations for 2 4 Difluoro N 2 methoxy 5 4 4 morpholinyl 6 quinazolinyl 3 pyridinyl benzenesulfonamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed with 2 × SYBR mix (TaKaRa) in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... fbf-2 cDNA was cloned into the pGBTK vector (Clontech) and transformed into PJ68-4a yeast strain (MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4Δ gal80Δ LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ ...
-
bioRxiv - Immunology 2022Quote: ... NETs were treated with 2 U micrococcal nuclease (Takara Bio) for 10 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Advantage 2 PCR kit (Takara/Clontech Cat # 639207). Libraries were checked for quality and approximate concentration on a 1% agarose gel.
-
bioRxiv - Neuroscience 2024Quote: ... and the Advantage 2 PCR kit (Takara/Clontech Cat # 639207). Libraries were checked for quality and approximate concentration on a 1% agarose gel.
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg of pEGFP-C1 (Takara-bio, discontinued by supplier), and 1.5 μg of bcl-xl/pcDNA3 in 70 μl of DMEM ...
-
bioRxiv - Microbiology 2024Quote: ... and genotyping was performed using advantage 2 polymerase mix (TaKaRa). The genotyping strategies are described in supplementary figures 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RACE was performed using Advantage 2 Polymerase Mix (Clontech Laboratories). The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-E-cadherin mAb (ECCD-2, IB) from TaKaRa; Goat anti-LXR alpha + LXR beta pAb (ab24362 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were cloned using the SMARTer RACE 5’/3’ Kit (Takara, Cat No. 634858) and then sequenced (Beijing Genomics Institution ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Cancer Biology 2024Quote: ... The wild-type AKT1 (NM_001014431.2) was cloned in the pECMV-3×FLAG-N vector using the In-Fusion® HD Cloning Kit (Takara Bio, Cat# 639650). The K20R and K20Q mutant AKT1 plasmids were constructed using the Fast Site-Directed Mutagenesis Kit (TIANGEN ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... The transformants were grown on SD -Trp plates (Clontech, 2% agar) for selection ...
-
bioRxiv - Developmental Biology 2020Quote: ... Laminin-511 E8 fragment (Takara Bio, #T303, 0.05 – 2 µg/ml) and Laminin-521 (Biolaminin ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was applied to 2 ml Talon Superflow resin (Clontech) pre-equilibrated with buffer A (20 mM Tris/HCl pH 7.5 ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... PCR amplification was done using Advantage HF 2 DNA polymerase (Takara) for 30 cycles according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: The GAL4-based Matchmaker yeast 2-hybrid system (Clontech Laboratories Inc.) was used for yeast-two-hybrid analysis ...
-
bioRxiv - Cancer Biology 2022Quote: U-2 OS Tet-On cells were purchased from Clontech (#630919). MDA-MB-453 cells were purchased from the American Type Culture Collection (ATCC ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Plant Biology 2021Quote: ... Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA) was used for the process of yeast transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the supernatant was nutated with 2 mL of TALON resin (Takara) for 45 min ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 1x Titanium Taq buffer and 2 μL Titanium Taq polymerase (Takara) were mixed in 50 µL total volume ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... which were carried out by Advantage® 2 Polymerase (Takara Bio). Final products were outsourced for Sanger sequencing (HyLabs ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 2 ug Retronectin (TaKaRa Cat. no. T110A), 1 ug anti-mouse CD11a (LFA1) ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in Mesenchymal Stem Cell Growth Medium 2 (TaKaRa Bio) supplemented with penicillin/streptomycin/amphotericin B (Wako) ...
-
bioRxiv - Biophysics 2024Quote: ... the sample was applied to 2 ml Talon Superflow resin (Clontech) pre-equilibrated with buffer A ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... which was performed using a SMARTer RACE 5’/3’ Kit (Clontech Laboratories, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... Yeast transformation was conducted with Yeast Transformation System 2 (Clontech NO.630439). All primers used were listed in supplementary Table 1.
-
bioRxiv - Microbiology 2020Quote: ... 2 µl of dNTP mix (TaKaRa, 2.5 mM concentration, 200 µM final), 0.125 µl of HotStart ExTaq (TaKaRa ...
-
bioRxiv - Biochemistry 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... before loading into a TALON® 2 ml Gravity Column (Takara 635606). Columns were washed one additional time before elution in a single step (150 mM Imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... a set of primer/probe E484A (SARS-CoV-2) (Takara, Cat# RC322A) was used ...