Labshake search
Citations for Takara Bio :
4301 - 4350 of 6421 citations for Rat Epithelial membrane protein 1 EPN3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... An equal amount of RNA for each sample was converted to cDNA using PrimescriptTM RT Reagent Kit (Takara Bio), or Superscript IV (Thermofisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... by seamless cloning according to the instruction of In-fusion® HD Cloning Kit (Clontech, Palo Alto, CA, USA). NLS was inserted into pcDNA3.1 using High-Efficient Ligation Reagent Ligation High (TOYOBO) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products of EgGLUT1-ss gene were recovered from Agarose Gel with Agarose Gel DNA Extraction Kit (Takara, Japan), and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA libraries were prepared by the core using Takara’s SMART-seq v4 Ultra Low Input RNA Kit (Takara 634888) and sequenced on Illumina’s NovaSeq 6000 platform ...
-
bioRxiv - Microbiology 2021Quote: ... indexed cDNA libraries were prepared using the SMARTer Stranded RNA-Seq Kit (Takara Bio USA, Mountain View, CA, USA). Library preparation was performed according to the instructions ...
-
bioRxiv - Biochemistry 2022Quote: One μg of RNA per kidney half was reverse-transcribed using PrimeScript RT Reagent kit (RR037 TAKARA, Shiga, Japan). Two μl of cDNA was used for quantitative real-time PCR to assess gene mRNA expression ...
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and then was transcribed to cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was used for preparing cDNA using PrimeScript™ 1st strand cDNA Synthesis Kit (Clontech) following the manufacturer’s protocol.
-
bioRxiv - Genetics 2019Quote: ... First-strand cDNA was reverse transcribed from 1μg of total RNA using the PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa). Rice ubiquitin (UBQ ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sub-cloning was done by using the In-Fusion PCR cloning kit (Clontech Laboratories, Mountain View, CA, USA). Plasmids were integrated at the lys1 gene locus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Full length cDNA synthesis was done from polyA RNA using Clontech SMARTer PCR cDNA synthesis kit (Clontech Laboratories; (23)) ...
-
bioRxiv - Immunology 2019Quote: ... The libraries were prepared using the SMARTer® Stranded Total RNA-Seq - Pico Input Mammalian - kit (Takara Bio, USA) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... followed by self-circularization using the In-Fusion HD Cloning Kit (Cat# 639648, Clontech Laboratories, Mountain View, CA, USA).
-
bioRxiv - Immunology 2019Quote: ... cDNA and library preparation were performed with a SMART-Seq v4 Ultra Low Input RNA Sequencing Kit (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified genes were cloned in the pOPIN_S vector [40] using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified genes were cloned in the pOPIN_S vector [40] using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with 1.0 μg of scrambled or Rai1-shRNA-expressing plasmids with the CalPhos Transfection kit (ClonTech) or Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and pBS2_Pericentrin C-ter_InsR: CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and 250 ng RNA of each sample was reverse transcribed to cDNA using the Primescript RT kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized at 44°C for 15 min using the PrimeScript RT reagent kit with gDNA eraser (TaKaRa) and a y300 PAT universal C10 primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram of total RNA was reverse transcribed by the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, RR047A). Quantitative PCR was performed in technical duplicates with FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... The mRNA expression was quantified using the SYBR green PCR kit (TaKaRa SYBRR Premix Ex Taq. II, Dalian, China) in a CFX96 Touch apparatus (Bio-Rad ...
-
bioRxiv - Genomics 2019Quote: ... Amplified fragments containing 145 bp sequence were then cloned into pGL4.23 vector using In-Fusion HD Cloning kit (Clontech). The resulting constructs were co-transfected with renilla luciferase into melanoma cell lines (UACC903 and UACC502 ...
-
bioRxiv - Neuroscience 2020Quote: ... Library Preparation and mRNA Sequencing: The cDNA libraries were prepared using a SMART-Seq® HT Kit (TAKARA Bio) and a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: Total RNAs were extracted using TRIzol reagent and reverse-transcribed into cDNAs using the PrimeScript RT reagent kit (TaKaRa). RT-qPCR was performed using KAPA SYBR FAST qPCR master mix (Kapa Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and were cloned into the KpnI restriction site of pEF-BOS using an In-Fusion Cloning Kit (TaKaRa Bio.). A FLAG-tag sequence was inserted just after the start codon ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... a DNA library of 220 bp insert size was prepared using the PrepX ILM 32i DNA Library Kit (Takara), and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat ...
-
bioRxiv - Biophysics 2019Quote: ... and the products were further purified in 3% agarose-TBE gels and subsequently reisolated using gel-purification kits (Clontech).
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was reverse transcribed with a PrimeScript II 1st strand cDNA Synthesis Kit (no. 6210A; Takara Bio, Kyoto, Japan). Based on the information at RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq) ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were converted to cDNA and amplified using Smart-Seq V4 Ultra Low Input RNA Kit (Takara Bio). The cDNA output was then processed with Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 [88] using the In-Fusion HD Cloning kit (Clontech) as described previously [89] ...
-
bioRxiv - Immunology 2021Quote: ... RNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Clontech/Takara). The input quantity of total RNA was comprised between 1 and 22ng ...
-
bioRxiv - Immunology 2021Quote: ... RNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Clontech/Takara). The input quantity of total RNA was comprised between 1 and 22ng ...
-
bioRxiv - Cell Biology 2021Quote: ... was then subcloned into the expression vector RH2.2 (kind gift of S. Sidhu) using the In-Fusion Cloning Kit (Takara) and sequence-verified.
-
bioRxiv - Molecular Biology 2020Quote: ... was purified using the manufacturer’s instructions and used to prepare libraries with SMART-Seq v4 Ultra Low Input RNA Kit (Clontech) followed by sequencing on a NextSeq 500 instrument (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcribed RNA from sorted cells was generated by SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio). Real-time PCR was performed using a Fast SYBR green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: The synthesis of the cDNA was performed using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio). 3,000 to 4,500 frozen sorted cells were lysed using a concentration of 100 cells per µl of lysis buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... University of Turin) and sub-cloned into a pCS2+ backbone using the In-Fusion® HD Cloning Kit (Clontech). MLS_mStat3_NES CDS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 (69) using the In-Fusion HD Cloning kit (Clontech) as described previously (70) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3*106 HEK 293T cells were plated in 10 cm plates and transiently transfected with pLVX-DSB-Spectrum and packaging vectors (pCMV-VSVg and pCMV-ΔR8.2) using the CalPhos mammalian transfection kit (Clontech). Virus-containing medium was filtered through a 0.45 μM filter ...
-
bioRxiv - Cell Biology 2021Quote: ... The adipocyte-containing liquid was serially applied to a NucleoSpin® Filter Column (NucleoSpin RNA XS Kit, Takara, 740902) for on-column BMA lysis and RNA extraction ...
-
bioRxiv - Immunology 2020Quote: cDNAs were generated from isolated RNAs using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2020Quote: cDNAs were generated from isolated RNAs using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Pathology 2021Quote: ... Complementary DNA was synthesized using the PrimeScript™ RT reagent Kit supplemented with a gDNA Eraser (TaKaRa, Dalian, China) and random primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 1μg of extracting RNA was reverse transcribed into cDNA using the PrimeScript 1st strand cDNA Synthesis Kit (Clontech) according to the manufacture’s specifications ...
-
bioRxiv - Cell Biology 2020Quote: ... The complementary DNA (cDNA) was synthesis via reverse transcription reaction using a PrimeScript RT reagent kit (Takara, South Korea) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Then singlet and duplet pools were separately ligated overnight into the SuRE barcoded vector using Takara ligation kit version 2.1 (#6022; Takara). Ligation products were purified using magnetic bead purification (#CPCR-0050 ...