Labshake search
Citations for Takara Bio :
4001 - 4050 of 5103 citations for Serum Zinc Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: RNA libraries of esophageal epithelial tissue biopsies and organoids were prepared using SMART-Seq HT Ultra Low Input RNA kit (Clontech) and NEBNext Ultra II RNA Library Prep Kit for Illumina ...
-
bioRxiv - Immunology 2024Quote: ... and quantified using bulk RNA-seq (Psomagen) after construction of Illumina sequencing libraries using the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara). Noise from low-expression transcripts was filtered ...
-
bioRxiv - Immunology 2024Quote: ... we ran our linearized plasmid backbone and 83 bp PCR products on a 1% agarose gel and recovered each using the Gel and PCR Clean-up Kit (Takara) per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... complete sequences of the three genomic segments of AV2 were obtained by 5ʹ- and 3ʹ-RACE with the SMARTer RACE cDNA amplification kit (Clontech) using infected Nicotiana occidentalis leaf material (DSMZ ...
-
bioRxiv - Neuroscience 2024Quote: ... and then the tip of the recording electrode was broken into the nested PCR reagent system (Prime ScriptTm RT reagent Kit with QDNA Eraser, Cat: RR0471, Takara), and a cDNA synthesis kit was used to synthesize cDNA following the manufacturer’s protocol (PrimeScriptm II1st Strand cDNA Synthesis Kit) ...
-
bioRxiv - Cell Biology 2024Quote: RNA sequencing libraries of rRNA-depleted nuclear RNA or polyA RNA were prepared with SMARTer Stranded Total RNA-Seq Kit v2 (Takara) according to the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2024Quote: ... and introduced into linearized (with KpnI) pCGEN (Motteram et al. 2011) using the In-Fusion HD Cloning Kit (Takara Bio). The resulting vectors ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... Three nanograms of total RNA were used for amplification using the SMART-Seq V4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s recommendations (10 PCR cycles were performed) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Reporter plasmid libraries were made by cloning amplified ATAC fragments into AgeI-HF- and SalI-HF-linearized pSTARR-seq plasmid using InFusion HD cloning kit (Takara) and then propagated in MegaX DH10B T1R electrocompetent bacteria ...
-
bioRxiv - Developmental Biology 2024Quote: ... Library construction started from 4.9ng of RNA per sample made using the SMARTer Stranded Total RNA-seq Kit v3-Pico Input Mammalian (Takara; 634486). The quality of libraries was checked with the with the High Sensitivity DNA Reagents Kit (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 1 ng RNA was used as input to generate cDNA with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Microbiology 2023Quote: ... the pLVX-G9R+A1L-puromycin or pLVX-G9R+A1L-blasticidin plasmids were transfected into 293T cells using the Lenti-X Packaging Single Shots kit (631275, TaKaRa). Lentiviral supernatants were harvested 48 hours post-transfection and filtered through a 0.45 μm membrane (SLHV033RB ...
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Neuroscience 2023Quote: RNAs were extracted from cultured cells and tissues using RNA extraction kit and reverse transcribed into cDNAs (both from TAKARA) according manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... except that raw read processing by Cutadapt had to be adapted to different library construction method (SMARTer smRNA-Seq Kit, TAKARA). In particular ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... the transfer plasmid (pBABEpuro-based or pLZRS-IRES-ΔNGFR/GFP-based) and pCMV-VSV-G were co-transfected into GP2-293 packaging cells using CalPhos mammalian transfection kit (Takara/Clontech) according to manufacturer’s protocol ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... was digested with NheI and KpnI and the Lmx1a CDS and IRES-GFP fragments were inserted using the In-Fusion HD Cloning kit (Takara). Molecular biology kits used are listed in Table T4.
-
bioRxiv - Genetics 2023Quote: ChIP-seq libraries were prepared starting with ∼1000 picograms of ChIP or input DNA samples using the ThruPlex DNA-seq kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... First-strand cDNA was synthesized using 1.5 µg RNA and Prime Script™ RT reagent Kit with gDNA eraser (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Plant Biology 2023Quote: ... the promoter fragment was amplified and cloned between HindIII and XbaI sites using In-Fusion® HD Cloning Kit (Takara), generating pGWB502-HSP90.7pro ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was derived from foreskin-fibroblasts using the Stemgent mRNA Reprogramming Kit (Stemgent) as described previously (40) and maintained in a feeder-free culturing system Cellartis DEF-CS 500 (Takara). The inducible SpCas9 cell line was generated as described earlier (41).
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed using first-strand cDNA and a primer pair designed for target genes using the SYBR Premix Ex Taq Perfect Real Time Kit Tli RNAaseH Plus (TAKARA) and Thermal Cycler Dice Real Time System (Model TP800 ...
-
bioRxiv - Cell Biology 2023Quote: AAV plasmids were prepared by subcloning the ORF to pAAV-CAG-DNP63A7 or using the In-Fusion HD Cloning kit (Clontech).
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and was further reverse-transcribed into cDNA through the PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa). A LightCycler 480 II (Roche Applied Science ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicon was then cloned into the EcoRI and NotI recognition site of the expression plasmid pCAG neo using HD Cloning Kit (TaKaRa). To construct deletion mutants of bovine hnRNPM ...
-
bioRxiv - Microbiology 2023Quote: ... The resultant reaction mixture was then 10-fold diluted and subjected to quantitative PCR using TB Green Premix Ex Taq II kit (TaKaRa) in combination with a tag primer (no ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription reaction was set up using the cleaned-up RNA (1.6µg) using PrimeScript™ RT reagent Kit (Takara, Japan). The RT reaction was carried out with buffering temperature at 25 ºC for 2 mins ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... n = 3 pools of 250 GFP+ cells were collected for direct RNA-Seq library preparation using the SMART-Seq HT PLUS kit (Takara), according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral constructs pCMV-VSV-G and pCMV-dR8.2 dvpr 98 were transfected in HEK293T cells by the calcium-phosphate method (CalPhos Mammalian Transfection Kit, Takara, 631312) for virus production ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was extracted from PAMs using the TRIzol reagent and was reverse transcribed using the PrimeScript RT kit (TaKaRa). qPCR was performed using the PowerUp SYBR Green Master Mix on the ABI StepOnePlus system ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were ligated into pACT7_SC14 (HBB minigene reporter as previously described (31) using homology-based cloning technology (In-Fusion HD Cloning kit, Takara Bio). Following sequence verification ...
-
bioRxiv - Plant Biology 2023Quote: ... The tissue was fixed for 30 min and the immunoprecipitation performed using a SEP3-specific antibody followed by library preparation using ThruPLEX DNA-Seq Kit (Takara) and deep sequencing65 ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was then used for library preparation using the SMARTer small RNA (smRNA)-seq kit for Illumina (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and cloning it into the EcoRI and EcoRV sites of pcDNA-EGFP-P2A in frame with the tag sequence by using an In-Fusion® HD Cloning Kit according to the manufacturer’s instructions (Takara). pcDNA-hAPOBEC1 was constructed by cloning the XhoI-HindIII fragments of pUC57-APOBEC1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA encoding HsPINK1 was inserted into the BamHI site of pcDNA5/FRT/TO CMVd3 vector (pcDNA5d3, see (17)) using the In-Fusion HD Cloning Kit (Takara). For stable expression ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNAs were cloned into the pmCherryC1 vector using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... the agarose gel pieces were cut out and digested using NucleoSpin® Gel and PCR Clean-Up kit (Takara, 740609), according to the manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2023Quote: TssM193-490 coding region was obtained by gene synthesis (IDT) and cloned into pOPIN-K vector45 using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were introduced using the QuikChange Lightning kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatants of infected cells were collected and infectious virus particles were measured using the Adeno X Rapid Titration Kit (Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA was subjected to reverse transcription to generate RNA cDNA using the widely recognized PrimeScriptRT kit (Takara, Kyoto, Japan) provided by the esteemed Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were purified and ligated into the pMD-20 vector or the pANT vector using the Mighty TA- cloning Kit (Takara) or TA-Enhancer Cloning Kit (Nippon Gene ...