Labshake search
Citations for Takara Bio :
351 - 400 of 689 citations for S 3 Amino 4 4 cyanophenyl butanoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected with plasmids expressing either SARS-COV-2 S protein WT or mutants (E1182K, L1193G, E1182K/L1193G, L1182K/L1186G/L1193G) by using Calcium phosphate transfection kit (Takara-Bio). 24 h post transfection ...
-
bioRxiv - Immunology 2022Quote: ... the variant HXP-S were inserted into the pNDV_LS/L289A rescue plasmid (between P and M genes) by in-Fusion cloning (Clontech, CA, USA). The recombinant product was transformed into MAX Efficiency™ Stbl2™ Competent Cells (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio). pSFG-SARS-CoV-2 S D614G was cloned from pSFG-SARS-CoV-2 S plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) ...
-
bioRxiv - Neuroscience 2020Quote: ... The subcloning of FPs into respective vector(s) was done either by restriction enzyme (RE) digestion or by using In-Fusion PCR system for seamless cloning (Clontech, USA). Expression in HEK293 and mouse primary neuronal cells was facilitated by using vectors with either CMV or hSyn promoter ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP 61,62 (400ng) using TransIT-LT1 (Takara, Cat# MIR2306). On day 3 (24 hours post transfection) ...
-
bioRxiv - Biochemistry 2024Quote: ... were obtained by gene synthesis (IDT) and cloned into pOPIN-S vector 36 using the In-Fusion HD Cloning Kit (Takara Clontech). SnJOS2 was amplified from S ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293 cells were cotransfected with the expression plasmids for D614G S or D614G/P681R (400 ng) with pDSP1-7 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Biochemistry 2022Quote: ... S domains and variants were purified similar to S protein using nickel resin (10 mL/L, His60 Ni2+ superflow resin, Takara cat# 635664) with wash buffer (25 mM MES ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (ref.65) (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). On day 3 (24 hours posttransfection) ...
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal 3xFLAG-tagged ORF67.5 expression plasmid was constructed using the insert extracted from a previously constructed N-terminal 2×S-tagged ORF67.5 expression plasmid digested with EcoRI and SalI (Takara Bio, Shiga, Japan) (32) ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (ref.58) (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). On day 3 (24 hours posttransfection) ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (ref.69) (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). On day 3 (24 hours post-transfection) ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (ref.59) (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). On day 3 (24 h posttransfection) ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Bioengineering 2024Quote: ... AphAI was amplified using primers 9 and 10 listed in Supplementary Table 1 from pEPkan-S and inserted into the PstI site of pmRFP using the In-Fusion® HD Cloning Kit (Takara Bio USA).
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... 45 cycles from 10 s at 95°C to 30s at 60°C using TB Green ® Premix Ex Taq™ GC (Takara Bio, Japan).
-
bioRxiv - Genomics 2024Quote: ... Nucleic acids were then extracted using the NucleoSpin Gel and PCR Clean-up XS Kit (Takara Bio 740611.250).
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...