Labshake search
Citations for Takara Bio :
351 - 400 of 757 citations for Recombinant Influenza A virus HA protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Each well of the 96-well plate contained 3µL lysis buffer (10U Recombinant RNase Inhibitor (Takara Bio), 0.2% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... RLK7ECD was fused with MIK2TK and inserted into the pUC19 vector using in-fusion recombinant enzymes (Clontech). After digestion with KpnI and SalI ...
-
bioRxiv - Microbiology 2021Quote: ... All expression vectors used the recombinant DNA techniques used the In-Fusion HD enzyme (Clontech, Felicia, CA). A series of deletion mutants of eqkeap1 (eqKeap1-ΔNTR ...
-
bioRxiv - Cancer Biology 2019Quote: Lysis plates were created by dispensing 0.4 µl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% TritonTM X-100 (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcriptase-containing pseudoviral particles and recombinant reverse transcriptase standard of known concentrations (TAKARA, Cat. No. RR047A) were 10-timed diluted with nuclease-free water (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: GFP-OPTN pEGFPC2 has been described previously [54] and was subcloned into the pLXIN retroviral packaging plasmid (Clontech) for stable cell line production ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... The construct was cloned into a lentiviral transfer vector containing the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (pLVX series, Clontech, Mountain View, CA) under the human synapsin 1 promoter (hSyn ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Biophysics 2022Quote: ... containing virus was collected after 48 hrs and concentrated by 50-fold following the protocol of Lenti-X™ Concentrator (Takara, Cat. #: 631232). The concentrated virus in 40uL volume was added to HEK293T cells plated several hours ahead started with 80,000 cells in one well of a 24-well plate ...
-
bioRxiv - Bioengineering 2023Quote: ... CCR5-KO donor rAAV6 virus was produced in HEK-293T cells and was purified with AAVpro Purification Kit (TakaRa, San Jose, CA, USA). Electroporation of the RNP complex was performed using the Lonza 4D-Nucleofector (Lonza Group Ltd ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Cell Biology 2020Quote: ... fused with the SYFP2 coding region using recombinant PCR and cloned into pMSCV-Thy-IRES 1.1 vector (Clontech) using EcoRI/XhoI and ClaI restriction sites.
-
bioRxiv - Microbiology 2020Quote: ... for 15 min at 37°C in the presence of 80 U of recombinant RNase inhibitor (Takara Bio). Next ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant yeast strain was confirmed by PCR conducted with Matchmaker™ Insert Check PCR Mix (TAKARA, Japan). The full length of SlBES1.8 coding sequence was cloned into pGADT7 plasmid and subsequently transformed into the recombinant yeast strain ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Immunology 2020Quote: ... Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: Lysis plates were prepared by dispensing 0.4 µL lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Cells were lysed using Takara Bio Single Cell Lysis Buffer containing a recombinant RNase inhibitor (Takara Bio Inc.) then snap frozen ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Genomics 2021Quote: ... tissue or cells were placed in 2mL of EZ lysis buffer containing Recombinant RNase Inhibitor (Takara Bio 2313A), dounced 24 times with pestle A ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA was extracted using the hot phenol method and treated with recombinant DNase I (Takara, cat# 2270A) in the presence of RNasin Plus (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... for 15 min at 37°C in the presence of 80 U of recombinant RNase inhibitor (Takara Bio). Next ...
-
bioRxiv - Immunology 2023Quote: ... 0.6% NP-40 and freshly added 1mM DTT) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B) and incubated for 5 minutes on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Cancer Biology 2020Quote: ... full-length Bcor cDNA or truncated BcorΔE9-10 cDNA was cloned with an N-terminal HA tag into pCAG vector using InFusion (Takara). pCMV-SPORT 6.1 with mouse Bcl6 cDNA was purchased from Horizon Discovery (Clone ID 6309948).
-
bioRxiv - Cell Biology 2021Quote: WIPI3-HA construct used for expression in mammalian cells (pJC248): a gBlock (IDT) encoding WIPI3-HA was assembled by Gibson cloning with PCR amplified pcDNA3.1+ (Clontech). ss-HA-CPD in pEGFP_N1 (pJC338) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The codon optimized sequence for human GPRC5D expression in mammalian cells was synthetized by Integrated DNA Technologies as a gene block and inserted into a pcDNA3.1 vector including a C-terminal HA-tag using In-Fusion HD Cloning technology (Clontech). The full-length sequences of all the orphan GPCRs (except GPR158 and GPR179 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human eRF1 coding sequence was cloned into the XhoI and HindIII sites of the pλN-HA-C1 vector (Clontech). The pλN-HA-C1-eRF1 plasmid was then used to generate the pλN-HA-C1-eRF1AAQ (G183A G184A ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Zfp131 cDNAs were fused to 1x hemagglutinin (HA) tag and cloned into p2lox plasmid using In-fusion (Clontech) cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... and verified whether it has self-activation reaction through synthetic dropout (SD)-Ade-His-Leu-Trp (Clontech, CA, USA) with X-α-galactosidase (x-α-gal) ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus particles were collected 24 hours and 48 hours after transfection and concentrated with Lenti-X™ Concentrator (Takara, California, USA, Cat#631232). The pellets were then resuspended with PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were tagged with Gfp (enhanced green fluorescent protein; Clontech, Mountain View, CA, USA) at their N-terminus unless noted otherwise ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Developmental Biology 2021Quote: The cDNAs for HA-tagged ELF3 were amplified from the KhES-1 cDNA library by PCR using PrimeSTAR GXL (Takara) and were subcloned into the pENTR/D entry vector (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA fragment of human METTL18 with a C-terminal HA sequence was cloned into AgeI and EcoRI sites of the pQCXIP vector (Clontech). To generate hMETTL18-Asp193Lys-Gly195Arg-Gly197Arg-HA ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’AAGGGTAAGCGCTAGCGTCGGAGAAGAGGCTGGC3’) and insertion into the EcoRI/NheI sites of pAAV-hSyn-BioID2-Linker-BioID2-HA using In-Fusion cloning (TaKaRa). pCAG-ChrimsonR-tdTomato-P2A-HA-PA Rac1 (DN ...
-
Abl kinase deficiency promotes AKT pathway activation and prostate cancer progression and metastasisbioRxiv - Cancer Biology 2020Quote: ... The Abl sh3 retroviral construct has a pZIP-mCMV-ZsGreen backbone (Transomics Technologies) and the Arg sh2 retroviral construct has a pSIREN RetroQ vector backbone (Clontech).
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...