Labshake search
Citations for Takara Bio :
351 - 400 of 1011 citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Ten colonies picked up with a tooth pick were diluted in 1ml 0.9%NaCl and spotted onto SD/-Ade/-His/-Leu/-Trp medium (Clontech, 630428) with or without a-X-Gal (GoldBio ...
-
bioRxiv - Microbiology 2022Quote: ... One μg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... medium and 10-fold dilutions of these cultures were dropped on SD control (−2) and selective medium additionally lacking His (−3) (Clontech). Empty vectors were used as negative controls ...
-
bioRxiv - Physiology 2022Quote: ... and cDNA libraries were generated using SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio, Inc., Kusatsu, Japan). Libraries were high-output single-end sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was obtained by centrifugation of the cell lysate at 10,000 g for 30 minutes and applied into the His TALON™ gravity column (Clontech). The columns were washed to remove the non-target proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting amplicons were cloned into pKTS786 (a pcDNA 3.1/V5-His based vector) that had been linearized with BstX1 with an In-Fusion HD cloning kit (Takara 638909) (76) ...
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Molecular Biology 2020Quote: Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each well of the 96-well plate contained 3µL lysis buffer (10U Recombinant RNase Inhibitor (Takara Bio), 0.2% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... RLK7ECD was fused with MIK2TK and inserted into the pUC19 vector using in-fusion recombinant enzymes (Clontech). After digestion with KpnI and SalI ...
-
bioRxiv - Microbiology 2021Quote: ... All expression vectors used the recombinant DNA techniques used the In-Fusion HD enzyme (Clontech, Felicia, CA). A series of deletion mutants of eqkeap1 (eqKeap1-ΔNTR ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcriptase-containing pseudoviral particles and recombinant reverse transcriptase standard of known concentrations (TAKARA, Cat. No. RR047A) were 10-timed diluted with nuclease-free water (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: The plasmid constructs used as repair template for recombinant virus generation were generated using InFusion cloning (TaKaRa). The sequence references below are based on the HSV-1 KOS genome accession number JQ673480 (Macdonald et al 2012) ...
-
bioRxiv - Molecular Biology 2020Quote: ... To generate the light-inducible clustering constructs, the CRY2olig sequence (Taslimi et al., 2014a) was inserted with a c-terminal mCherry tag (Clontech) into pGEMHE to generate pGEMHE-CRY2olig-mCherry ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... and tandem repeat Sgo_R3-4 (aa 621– 789) were cloned downstream of a hexahistidine tag and 3C protease specific linker by the In-fusion method (Clontech; primer sequences listed in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... siRNA resistant WRN transgenes containing a C-terminal 3xFLAG tag (designated WRNr) were synthesized and inserted into the lentiviral pLVX-IRES-puro plasmid vector (ClonTech) at GenScript ...
-
bioRxiv - Cancer Biology 2021Quote: ... and HRas was purified via its 6His affinity tag using immobilized metal affinity chromatography (TALON® Metal affinity resin (Takara)) followed by elution using an imidazole step gradient ...
-
bioRxiv - Biochemistry 2023Quote: ... Tm1 FL for motility assays was cloned with a HisSUMO-SNAP-tag between SacI and HindIII sites of the pET11 vector by InFusion cloning (Takara). The SNAP-Tm1 1-335 truncation was made by site- directed mutagenesis of the SNAP-Tm1 FL plasmid using primers that inserted a stop codon after aa 335 as described above.
-
bioRxiv - Microbiology 2023Quote: ... and cloning it into the EcoRI and EcoRV sites of pcDNA-EGFP-P2A in frame with the tag sequence by using an In-Fusion® HD Cloning Kit according to the manufacturer’s instructions (Takara). pcDNA-hAPOBEC1 was constructed by cloning the XhoI-HindIII fragments of pUC57-APOBEC1 ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Developmental Biology 2023Quote: ... G9 deletion mutants were generated by PCR amplification or overlap extension PCR and inserted in frame with the MYC tag into the pCS2-MT-NLS expressing vector using the In Fusion Protocol (ST0345, Takara). All constructs were confirmed by Sanger sequencing.
-
bioRxiv - Biochemistry 2023Quote: Khc FL for in vitro studies was cloned with a HisSUMO-SNAP-3C-tag into MCS1 between BamHI and HindIII sites of the pFastBacDual vector by InFusion cloning (Takara). The Khc mutant constructs used for in vitro studies were generated by site-directed mutagenesis of the Khc FL plasmid using primers that either inserted a stop codon after aa 910 (Khc910 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The H2afx coding sequence from Mus musculus was ordered from Eurofins and cloned into the pOZ-N-FH backbone adding the 1xHA tag at the N terminus using the in-fusion HD cloning kit (#12141, Takara). Full length wild type H2afx coding sequence was then mutagenized to obtain the desired S139A point mutation.
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA for p53 WT or p53 QM was cloned together with the DNA sequence for an NH2-terminal FLAG tag into pRetroX-Tight-Pur (Clontech). Retroviruses with the vesicular stomatitis virus–G (VSV-G ...
-
bioRxiv - Molecular Biology 2024Quote: ... to replace the HA tag with a 3X-FLAG tag and then replaced the microhomology sequences for EXOSC3 or ZFC3H1 using In Fusion cloning (Takara). pCRIS-PITChv2-dTAG-BSD (BRD4 ...
-
bioRxiv - Bioengineering 2024Quote: ... The purified PCR product was cloned with a C-terminus 6-His tag into pET22b vector via NdeI/XhoI using the In-Fusion HD Cloning kit following the manufacturer’s protocol (Takara Bio). The construct was transformed into chemically competent E ...
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA-seq library was prepared using the SMARTer Stranded Total RNA Sample Prep kit - HI Mammalian (Takara Bio Inc, Shiga, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of RNA was used for library preparation with the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... this was followed by a second screening using the SD quadruple dropout (Leu−, Trp−, Ade−, and His−) selective medium (Clontech Takara Bio). After the elimination of duplicates containing the same AD/library plasmid via yeast-colony PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... suspensions of the transformants were spotted onto SD plates with dropout supplements: Leu/-Trp (cat #630417) or -Ade/-His/-Leu/-Trp (cat #630428) (Takara Bio). The strains used in this assay are listed in Table S1.
-
bioRxiv - Molecular Biology 2024Quote: 900 ng of total RNA isolated from HUVEC was used as input for SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... the amplified fragment was incorporated into the Bam HI site of pHSG396 using the In-Fusion HD cloning kit (TAKARA, Japan), resulting in the generation of pHSG396-ptrA.