Labshake search
Citations for Takara Bio :
351 - 400 of 1606 citations for Mouse Anti Canine Distemper Virus Surface Envelope Antibody 5 4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Immunology 2020Quote: ... Tcrb amplicons were prepared using a 5’RACE-based protocol with the SMARTer Mouse TCR α/β Profiling Kit (Takara #634402) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were anti-PLP (N-terminus; 1:5000, Rogers, 2008) anti-GFP (JL8; 1:2000 – 5000; Clontech); anti-alpha-Tubulin (DM1A ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP-CESA6 protein was detected using anti-GFP antibody (Takara, catalog # 632381) and SEC12 was detected using anti-SEC12 antibody (Bar-Peled and Raikhel ...
-
bioRxiv - Neuroscience 2021Quote: ... the primary antibody rabbit anti-dsRed (Takara Bio, Cat# 632496, 1:500) and the secondary antibody goat anti-rabbit ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DSRed antibody (Living Colours; Clontech; Cat# 632496, dilution 1:300), rabbit anti-red fluorescent protein (RFP ...
-
bioRxiv - Plant Biology 2022Quote: ... Blots were probed with anti-GFP monoclonal antibody JL-8 (632381, Clontech) diluted at 1/3000 in 1X PBS containing 0.1% Tween-20 and 5% non-fat milk ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were normalized to biosensor expression using an anti-GFP antibody (Clontech).
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then incubated with rabbit anti-DsRed primary antibodies (632496, Clontech) and donkey anti-rabbit AlexaFluor 594 secondary antibodies (711-585-152 ...
-
bioRxiv - Neuroscience 2022Quote: ... VTA slices were incubated with rabbit anti-dsRed polyclonal antibody (632496, Takara) as the primary antibody (1:1000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a dilution 1:000 of the anti-DsRed antibody (Takara; 632496) for mCherry were used ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (for immunohistochemistry 1:1000, Molecular Probes; for Western blotting: 1:10000, Clontech), mouse anti-Tubulin (1:80 ...
-
bioRxiv - Biophysics 2022Quote: Mouse anti-GFP mAb (catalog number 632381) was obtained from Clontech (San Jose, CA, USA). Mouse anti-mCherry mAb (catalog number NBP1-96752 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Signals for eGFP and FLAG were detected by using Mouse Anti-GFP JL-8 (Clontech), Mouse Anti-Flag (Sigma Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by SDS–PAGE and immunoblotting with goat anti-GST (1:3000, Cytiva, 27-4577-01) and mouse anti-6xHis (1:3000, Takara Bio, 631212) antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... Arr3 and Arr3-derived constructs were detected with rabbit anti-Arr3 (Ahmed et al., 2007) or mouse anti-GFP (Clontech JL-8) antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were incubated overnight at 4° C with anti-rabbit tdTomato (1:2000; TaKaRa, Cat# 632543, RRID:AB_2307319), anti-rabbit GFP (1:2000 ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... a mouse monoclonal antibody for bovine osteocalcin (code no. M042, clone no. OCG2; Takara Bio Inc., Shiga, Japan), and goat polyclonal antibody for FBXW2 (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... the slices were incubated overnight at 4°C with a rabbit polyclonal antibody against DsRed (1:1000, Takara Bio USA) diluted in a blocking solution of 0.3% Triton X-100 in PBS-DEPC ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated overnight at 4°C with primary antibody diluted in blocking buffer (these were: 1:200 Living Colors Ab, #632380, Takara; 1:100 L-plastin ...
-
bioRxiv - Cell Biology 2019Quote: ... Virus was produced by transfection of 293FT cells with pBABE- vimentin and pCL-Eco using Xfect transfection reagent (Clontech) and collection of supernatants 48 and 72hrs post transfection ...
-
bioRxiv - Immunology 2021Quote: ... 48hrs later the virus-containing supernatant from HEK-293T cells was concentrated 100-fold using Lenti-X concentrator (Takara). Titration was performed on HEK293T cells (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... Virus is produced by transfection of 293FT cells with pBABE-vimentin and pCL-Eco using Xfect transfection reagent (Clontech) and collection of supernatants 48 and 72 hours post transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... after which virus-containing supernatants were harvested and concentrated approximately 40-fold using Lenti-X Concentrator (Takara Bio, 631232) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... bone marrow was harvested and transduced with SINV virus on plates coated with 10 μg/cm2 Retronectin (T100, Takara) for 1.5-2 hrs at 650×g and 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was resuspended in cold PBS and titre was determined using Lenti-X p24 Rapid Titre Kit (Takara Bio) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Supernatant containing virus was collected 48 h later and 10-X concentrated using Lenti-X Concentrator (Takara Bio, Germany). AML-12 wild-type cells were transduced using concentrated virus and selected using 3 μg/mL of puromycin ...
-
bioRxiv - Cell Biology 2023Quote: ... after which virus-containing supernatants were harvested and concentrated 20-fold using a Lenti-X Concentrator (Takara Bio Inc.) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 13.32 (WT female) and 13.33 (WT male) were transduced with virus bearing either the empty pLVX-EF1a-IRES-ZsGreen1 vector (Takara), or the same plasmid expressing the coding sequence of C181 as described in lentivirus transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-nc82 (mouse, 1:10; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) and anti-DsRed (rabbit, 1:500; Takara Bio, Kyoto, JP). Brains were washed three times again in PBS with 0.2% Triton X-100 and transferred into secondary antibody solution (anti-chicken Alexa Fluor 488 ...
-
bioRxiv - Microbiology 2022Quote: ... Input and elution samples were analyzed by immunoblot using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Microbiology 2021Quote: ... The membranes were then incubated with either primary monoclonal antibodies anti-mCherry (Clontech #632543 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibody dilutions were used as follows: rabbit anti-DsRed 1:1000 (Takara), goat anti-ChAT 1:250 (Surmeli et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... sf-GFP-Sps1 was detected using JL-8 anti-GFP antibodies (Takara/Clontech) at 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... sf-GFP-Sps1 was detected using JL-8 anti-GFP antibodies (Takara/Clontech) at 1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with the following antibodies: rabbit anti-DsRed (1/200; 632476; Clontech; lot # 1306037), rabbit anti-β-Adaptin (1/200 ...
-
bioRxiv - Genetics 2023Quote: ... Slices were then incubated with anti-EGFP antibody (Takara Clontech 6323380; 1: 5.000) and anti ISL1 (AbCam cat no ab86472 ...
-
bioRxiv - Genetics 2023Quote: ... Slices were then incubated with anti-EGFP antibody (Takara Clontech 6323380; 1: 5.000) and anti ISL1 (AbCam cat no ab86472 ...
-
bioRxiv - Developmental Biology 2024Quote: Primary antibodies: Living Colors Polyclonal anti-mCherry/dsRed (rabbit, 1:500, Clontech 632496), anti-GFP (chicken ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the membrane was incubated overnight at 4°C with an anti-GFP monoclonal primary (JL-8; Clontech 632381) at 1:5,000 dilution ...