Labshake search
Citations for Takara Bio :
351 - 400 of 877 citations for Lysophosphatidic Acid Receptor 5 LPAR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Clear lysate was immediately passed through a 5 mL TALON™ Superflow cartridge (Takara Bio). After extensive washing with buffer A (50 mM HEPES pH 8.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... They were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and CCR6high and transduced with lentivirus particles at an MOI of 5 using retronectin (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cancer Biology 2023Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... Synthesized DNA was cloned into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was prelinearized with NotI-HF (New England Biolabs [NEB] ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Cla I sites 5′ to the BamH I site (Clontech, Mountain View, CA, USA).
-
bioRxiv - Immunology 2024Quote: ... QPCR was then performed with a reaction mixture consisting of 5 μL SYBR Green (Takara), 0.2 μL Rox ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 μg was used as template for cDNA synthesis using Smart MMLV reverse transcriptase (Clontech). All cloning PCRs were performed with an initial denaturation at 94 °C for 2.5 min ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Molecular Biology 2019Quote: Complete cDNA was synthesized from 5 ng total RNA using the SmartScribe reverse transcriptase (Takara Bio) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Cell Biology 2020Quote: ... and GFP was probed with the monoclonal JL8 antibody (Takara) and anti-mouse HRP conjugate secondary (Promega W401B) ...
-
bioRxiv - Cell Biology 2020Quote: ... the following antibodies were used: Rabbit anti-dsRed (Clontech #632496) 1:1,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-dsRed (1:1000, Living Colors DsRed Polyclonal Antibody, Takara). After rinsing 5x 10 min each in PBST ...
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with DsRed Polyclonal Antibody (Takara Bio # 632496) overnight in PBST (0.2% ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies used were: rat monoclonal mCherry (1:2000, Clontech); mouse monoclonal tyrosine hydroxylase (TH ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were as follows: rabbit anti-DsRed (Clontech) – 1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2022Quote: ... a mouse anti-mCherry primary antibody (Takara Bio, 1:5000) was used instead of the substance P primary antibody to visualize hM3Dq-mCherry or mCherry-expressing cells.
-
bioRxiv - Genetics 2020Quote: ... using monoclonal antibodies against Cas9 (Clontech, Palo Alto, CA, USA) or GFP (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed antibody (Living colors/Takara Bio, RRID: AB_10013483) and mounted in Vectashield (Vector labs ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-E-cadherin rat monoclonal antibody (Takara, M108, 1:500), anti-GFRα1 goat polyclonal antibody (R&D Systems ...
-
bioRxiv - Neuroscience 2022Quote: ... and iv) a polyclonal rabbit anti-DsRed antibody (632496, Clontech) diluted 1:200 in 3% PBT (for detecting the DenMark signal to label post-synaptic regions).
-
bioRxiv - Cancer Biology 2022Quote: ... Rabbit polyclonal antibodies used were: HECD1 (anti-E-cadherin; Takara), anti-Melan-A (ab15468 ...
-
bioRxiv - Neuroscience 2023Quote: ... a Living Colors® EGFP mouse monoclonal antibody (632569, Clontech), or a mouse monoclonal anti-actin antibody (clone AC-40 ...