Labshake search
Citations for Takara Bio :
351 - 400 of 1797 citations for Integrin beta 1 binding protein 1 ITGB1BP1 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... aprotinin (1 µg/ml) (T010A; TaKaRa), and 0.1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cancer Biology 2020Quote: ... the TET protein expression in each clone was checked by immunoblotting using TetR monoclonal antibody (Clone 9G9) (Clontech, cat#631131). In addition ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4.9 μg DNA was transfected per dish containing a 1:1 molar ratio of pmCherry-N1 (Clontech) and of the pUC18-GFP or linear GFP substrate ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLKO.1-shFEN1 or pLKO.1 control vector was simultaneously transfected into LentiX293T (Cat# 632180 Clontech, Japan) with packaging plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-st PCR (PCR 1) was performed using Titanium Taq DNA Polymerase (# 639209, Takara Bio, CA, USA). Separation of the PCR products from primers and gel purification was done by QIAquick PCR & Gel Cleanup Kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... floating coronal sections were rinsed in PBS and blocked for 1–2 hr at room temperature in a solution of 10% normal goat serum and 0.5% Triton X-100 dissolved in PBS and then incubated in blocking solution containing rabbit anti-DsRed polyclonal antibody (1:1000; Takara Bio, Mountain View, CA) with gentle agitation at 4°C for 18–22 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... the full-length ORF of PpGL2 fused with the GAL4 DNA binding domain in the PGBKT7 vector (Clontech, Japan) was transformed into the competent yeast strain Y2HGold ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: The coding region of s1pr1 was fused to the GAL4 binding domain of the “bait” pBT3-STE vector (Clontech) cloning at Sfi IA (5′-GGCCATTACGGCC-3′ ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then induced for the indicated amount of time with 1 μM Shield-1 ligand (Takara bio) to stabilize the TRF1-FokI protein and 1 μM 4-OHT (Cayman Chemical ...
-
bioRxiv - Plant Biology 2024Quote: ... Transformed yeast cells were grown under selective conditions in a minimal medium (46.7 g L-1 Minimal SD Agar Base [TaKaRa], 0.78 g L-1 uracil dropout supplement [TaKaRa]). Cytokinin transport assays were performed according to the method described by Zhao et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... The relative luciferase activity was determined by normalizing the firefly luciferase activity by the respective total EGFP protein amount quantified by Western blot using a GFP antibody (Clontech, 632460) in Image Studio ver 5.2 (LI-COR).
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Neuroscience 2022Quote: ... in PBS] for 90min followed by an incubation with a rabbit anti-DsRed antibody (1:2000, in blocking solution; Takara Bio-Living Colors, RRID #632496) overnight at 4°C ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti- dsRed (1:500; Takara Bio), guinea pig anti-Loaf (1:400 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-DsRed 1:1000 (Clontech, #632496), mouse anti-Arm 1:3 (Hybridoma Bank ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed (Clontech, 632496, 1:200), mouse anti-Tubulin (Sigma T5168 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:500, Clontech #632496), goat anti-rat 647 (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... and STEM121 (msIgG1, 1:200, Takara Bio). The nuclei were stained with Hoechst 33258 (10 µg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed (1:1000, 632496, Clontech); rabbit anti-HA (1:300 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). Membrane was then washed three times in 1x TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). The membrane was then washed three times in TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... expression vector pAS2-1 (Clontech, Enzifarma, Portugal). Bait-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1/500, Clontech, 632496). Sections were then incubated for 2 h at room temperature with appropriate fluorescent secondary antibodies diluted in PBS – 1% normal serum ...
-
bioRxiv - Microbiology 2021Quote: ... 1 unit Ex Taq polymerase (Takara Bio), forward and reverse primers (0.2 μM) ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1:1000) (632496, Clontech), goat anti-CGRP (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GFP 1:1000 (Clontech, 632380), anti-α-syn 1:1000 (C-20 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-dsRed (632496, Clontech; 1:300).
-
bioRxiv - Cell Biology 2020Quote: ... anti dsRed at 1:500 (Takara #632496), anti Polyubiquitin (“PolyUb” ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-DsRed (1:500; ClonTech). The secondary antibodies Cy3 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit α-DsRed (1:600, Clontech, #632496); rat α-mCherry (1:2000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry for mCherry (mouse, 1:1000, Takara; goat anti-mouse-alexa594 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μL of 10 mM dNTPs (Takara), 1 μL of 10 μM TSO primer (5’-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:500, Clontech #632496), goat anti-mCherry (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (1:500, Clontech). Secondary antibodies used were Alexa Fluor 633 goat anti-mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Anti-6xHis (631212, 1:10,000) from Clontech. Anti-Ubiquitin (646302 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-H3K27me1 (1:1000, Takara, #MABI0321-100I), anti-H3K27ac (1:4000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-dsRed (1:200, Takara, #632496), Alexa488 goat anti-mouse (1:500 ...
-
bioRxiv - Genetics 2020Quote: ... 1× PrimeSTAR GXL Buffer (TaKaRa Bio Inc.), 0.2 mM each dNTP ...