Labshake search
Citations for Takara Bio :
351 - 400 of 906 citations for Goat Anti Human IgM Species Adsorbed HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (Takara #632496), mouse anti-Actin (Sigma #A4700 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-DsRed (632496, Clontech). EdU+ cells were detected using the Click-iT EdU Imaging kit (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:200), anti-F-actin (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:10000), anti-actin (Abcam ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-mCherry (Clontech, 632543) 1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... mCherry (rabbit-anti-dsRed; Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-GFP (Clontech, 632381), 1:10,000 ...
-
Mask, the Drosophila Ankyrin Repeat and KH domain-containing protein, regulates microtubule dynamicsbioRxiv - Neuroscience 2021Quote: ... rabbit anti-mCherry (632496, Clontech) at 1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-DsRed (Takara, 632496), and mouse anti-Tnnt (ThermoFisher ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-GFP antibody (Clontech) for 1 hour at room temperature followed by a second incubation with HRP-conjugated secondary antibody (Santa Cruz Biotechnology) ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-RFP (Takara, 632543) primary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-DsRed (1:500, Clontech), anti-Synapsin I (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry (Clontech, 632543) at 1:450 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-dsRed (Takara Bio) 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-dsRed (Clontech, 632496) at 1:300 ...
-
bioRxiv - Neuroscience 2023Quote: Rabbit anti-Dsred (Takara 632496)
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed (632496, Clontech), rabbit anti-Lcp1 (Jin et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-tdTomato (Takara, Cat.# 632496), anti-K14 (Biolegend ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-Dsred (Takara, 632496), rabbit anti-VAChT (SYSY ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and TRIM27 cDNA was obtained in pENTR221 vectors from the UT Southwestern (UTSW) McDermott Center for Human Genetics and subcloned into pCMV-HA or pCMV-myc (Clontech, Mountain View, CA) between SalI and NotI restriction sites ...
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Immunology 2022Quote: ... Viruses were packaged in human embryonic kidney (HEK) 293 cells and viral supernatants were processed using Retro-X concentrators (Takara Bio. USA Inc). Naïve CD8 T cells were purified by negative-selection and stimulated in vitro with plate-bound anti- CD3/CD28 ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: anti-GFP (chick 1:20) and anti-DsRed (rabbit, 1:50, Takara Bio#632496). Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsred (1/1000; TaKaRa), mouse anti-acetylated Tubulin (1/500 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse JL8 anti-GFP (Clontech, 632381); mouse P124 anti-desmoglein 1 (Progen ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:100, Clontech).
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:250; Clontech), mouse anti-ratCD2 (OX-34 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-Dsred (1:250, Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:500; Clontech), mouse anti-rCD2 (OX-34 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:1000, Clontech), mouse mAb anti-ChAT (1:100 ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit anti-GFP antibody (Clontech #632377) was used at 1:5,000 dilution ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-RFP (1:1,000, Clontech), mouse monoclonal anti-Bruchpilot ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... rabbit anti-DesRed (Catalog #632392, Takara Bio USA ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-mCherry (632543, Takara, 1:1,000), anti-SUMO2/3 (ab3742 ...