Labshake search
Citations for Takara Bio :
351 - 400 of 6153 citations for Cow T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were transfected with given plasmids and then harvested for RNA extraction by NucleoSpin RNA Plus Kit (Takara) 48 hour after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and pBS2_Pericentrin C-ter_InsR: CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were converted to cDNA and amplified using Smart-Seq V4 Ultra Low Input RNA Kit (Takara Bio). The cDNA output was then processed with Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcribed RNA from sorted cells was generated by SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio). Real-time PCR was performed using a Fast SYBR green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by ELISA (eBiosciences ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2022Quote: ... and a subset (approximately 75,000 cells) was pelleted prior to RNA extraction using the NucleoSpin RNA Plus XS kit (Takara) following manufacturer protocol ...
-
bioRxiv - Immunology 2023Quote: cDNA was amplified from the collected cells using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech-TakaraBio). 1ng of amplified cDNA was used to generate barcoded libraries with the Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: TUNEL assays were performed to detect apoptotic cell death using Clonetech ApoAlert DNA Fragmentation kit (Takara, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA of the cell pellets was extracted and purified using a Nucleospin Blood XL kit (Takara Bio, #740950.10). Guides were amplified and barcoded by PCR using NEB Next Ultra ii Q5 MM (M0544L ...
-
bioRxiv - Immunology 2023Quote: ... Full-length cDNAs were generated directly from ~10,000 cells per sample using oligo(dT) priming and the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech), and 150 pg of cDNA was used to prepare strand-specific paired-end sequencing libraries (Nextera XT ...
-
bioRxiv - Cell Biology 2023Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by an ELISA kit (eBiosciences ...
-
bioRxiv - Genetics 2024Quote: ... cells were harvested and vectors were purified using the AAVpro purification kit (cat.: 6666; Takara Bio, Kusatsu, Shiga, Japan) as per manufacturer’s instructions and stored at -80 °C until further use ...
-
bioRxiv - Cancer Biology 2024Quote: ... Barcode sequence of each clone was PCR amplified directly from the cells using Terra PCR Direct Polymerase kit (Takara) for Sanger sequencing using previously described primers (5).
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated from cells or tumors using a Mini BEST Universal RNA Extraction Kit (Takara, Shiga, Japan). cDNA was prepared from total RNA by reverse transcription using oligo-dT primers (Takara) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and we immediately used these cells for reverse-transcription and cDNA amplification with a Smart-Seq HT kit (Cat# 634437, Takara). The cDNAs (1 ng each ...
-
bioRxiv - Neuroscience 2021Quote: ... Groups of 6-10 cells were dispensed from the micropipette into 1 µl ice-cold 10x reaction buffer (SMART-Seq v4 kit, Takara) and flash-frozen before library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara) by following the manufacturer’s instruction using gene-specific primers (S2 Table) ...
-
bioRxiv - Systems Biology 2020Quote: We extracted RNA from fixed cells after barcode RNA FISH and sorting using the NucleoSpin total RNA FFPE XS kit (Takara). We performed cell lysis and reverse cross-linking at 50°C for 90 minutes and otherwise followed the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: Cell death was measured by quantification of the lactate dehydrogenase (LDH) release into the cell supernatant using LDH Cytotoxicity Detection Kit (Takara). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Bioengineering 2022Quote: The cells were confirmed to be mycoplasma-negative every few months using a CycleavePCR Mycoplasma Detection Kit (CY232, Takara Bio).
-
bioRxiv - Immunology 2019Quote: ... 20 cells were sorted directly in cDNA synthesis buffer from the SMARTer Ultra Low RNA Kit for Illumina sequencing (Clontech) and used directly for cDNA synthesis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both CnAOEC and ISO-HAS-B were cultured in Endothelial Cell Growth Medium 2 Kit (Takara Bio, Inc. Kusatsu, Japan). All cells used were routinely tested for Mycoplasma using PCR and were submitted to ICLAS Monitoring Center (Kawasaki ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-RACE cDNA was obtained from bulk-sorted B cells of each animal with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The Ig PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 × 106 HEK293T cells were transfected with 4 μg donor and 2.5 μg pX330 Cas9 plasmid (CalPhos™ Mammalian Transfection kit, Clontech). After 72 h ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... retroviral packaging construct pTG5349 and a reporter pCCLSIN.cPPT.hPGK.GFP.WPRE into HEK 293T cells by calcium-phosphate method (Calphos Mammalian Transfection kit, Clontech as per manufacturer’s instructions). Cells were seeded on 60×15mm dish a day before transfection to achieve 70 – 80% confluency ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were originally obtained from ATCC (except MAGIC5 cells) and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection kit, Takara).
-
bioRxiv - Immunology 2021Quote: ... Cells were sorted directly into lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) and frozen until all samples were ready for simultaneous processing ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysis was quantified by measuring the amount of intracellular LDH release into the cell culture supernatant (TaKaRa LDH cytotoxicity detection kit; Clontech). Percentage PI uptake and LDH release were calculated relative to 100 % cell lysis in untreated control sample.
-
bioRxiv - Cell Biology 2021Quote: Transfection of Halo-tagged AnkB440 plasmids were conducted in HEK293T cells grown in 10 cm culture plates using the calcium phosphate transfection kit (Takara) and 8 µg of plasmid ...
-
bioRxiv - Genomics 2021Quote: ... Libraries from 4-cell embryos were also prepared using 18-30 nt gel purified RNA using the SMARTer smRNA-Seq Kit (Clontech) and NEXTflex-Small-RNA-Seq (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... 293T Lenti-X cells were seeded onto 10-cm Petri dishes and transiently transfected (CalPhos™ Mammalian Transfection Kit, Clontech Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting mutant BAC was electroporated into NEB 10-beta cells and purified using the Nucleobond BAC 100 kit (Takara).
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... n = 3 pools of 250 GFP+ cells were collected for direct RNA-Seq library preparation using the SMART-Seq HT PLUS kit (Takara), according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral constructs pCMV-VSV-G and pCMV-dR8.2 dvpr 98 were transfected in HEK293T cells by the calcium-phosphate method (CalPhos Mammalian Transfection Kit, Takara, 631312) for virus production ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatants of infected cells were collected and infectious virus particles were measured using the Adeno X Rapid Titration Kit (Takara Bio Europe ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4) and the protein contents of the cell lysate were quantified using a BCA Protein Assay Kit (TAKARA, T9300A) following the manufacturer’s protocol (Song et al. ...
-
bioRxiv - Immunology 2023Quote: 150-200 tuft cells were sorted directly into lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit (Takara) and cDNA generated following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: cfDNA in the conditioned cell culture medium was extracted using NucleoSpin Gel and PCR Clean-up kit (Takara, Duren, Germany), and quantified with Nanodrop (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... the transfer plasmid (pBABEpuro-based or pLZRS-IRES-ΔNGFR/GFP-based) and pCMV-VSV-G were co-transfected into GP2-293 packaging cells using CalPhos mammalian transfection kit (Takara/Clontech) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... the pLVX-G9R+A1L-puromycin or pLVX-G9R+A1L-blasticidin plasmids were transfected into 293T cells using the Lenti-X Packaging Single Shots kit (631275, TaKaRa). Lentiviral supernatants were harvested 48 hours post-transfection and filtered through a 0.45 μm membrane (SLHV033RB ...
-
bioRxiv - Neuroscience 2023Quote: RNAs were extracted from cultured cells and tissues using RNA extraction kit and reverse transcribed into cDNAs (both from TAKARA) according manufacturers’ instructions ...