Labshake search
Citations for Takara Bio :
351 - 400 of 5672 citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... culture plates were coated with RetroNectin (20μg/ml) (Takara) at 4o C ...
-
bioRxiv - Cell Biology 2022Quote: ... on agar plates containing indicated concentration of AureobasidinA (Clontech), Calcofluor White (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and the Mate and Plate Universal Human Library (Clontech). This yeast two-hybrid universal library was constructed from human cDNA that has been normalized to remove high copy number cDNAs (overrepresented transcripts ...
-
bioRxiv - Genetics 2022Quote: ... on RetroNectin-coated plates (10 μg/cm2, Takara Bio) for at least 2 h ...
-
bioRxiv - Genetics 2022Quote: ... on RetroNectin-coated plates (10 μg/cm2, Takara Bio). Cells were then transduced in the same medium ...
-
bioRxiv - Biochemistry 2021Quote: ... an aliquot of the lysate was used to measure protein concentration by BCA protein assay (Takara Bio). The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Genomics 2019Quote: ... 4μl 5× First-Strand buffer (Takara, #639538), and 1μl B-tag-sw oligo ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Plant Biology 2021Quote: Protein-protein interactions via yeast-two-hybrid (Y2H) assays were performed as described in the Matchmaker protocol (Clontech). HvRACB (amino acids 1-193 ...
-
bioRxiv - Biochemistry 2023Quote: ... Uncleaved protein and cleaved His6-Ztag domains were separated from cleaved protein by incubation with TALON resin (Clontech). The supernatant was buffer exchanged to MES A buffer (20 mM MES ...
-
bioRxiv - Neuroscience 2023Quote: ... 45 cycles from 10 s at 95°C to 30s at 60°C using TB Green ® Premix Ex Taq™ GC (Takara Bio, Japan).
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Bioengineering 2019Quote: ... met14) is grown at 30°C in YPDA medium (Clontech). Yeast transformants are selected by growth in Synthetic Defined (SD ...
-
bioRxiv - Cell Biology 2022Quote: ... Rapalog (A/C Heterodimerizer) was purchased from Takara (Cat #635056) and used at 1µM final concentration ...
-
bioRxiv - Molecular Biology 2019Quote: ... We inserted a green fluorescent C-terminal tag (EGFP; Clontech) analogous to a procedure used in a previous study [34] (for details ...
-
bioRxiv - Microbiology 2021Quote: ... HiBiT was linked to the C-terminal of ZsGreen (TAKARA) and transduced by lentivirus vector LVSIN-IRES-puro ...
-
bioRxiv - Microbiology 2020Quote: Tissue protein lysates were purchased from Takara. Details for each lysate are shown in Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... cell-free protein expression system from Takara Bio Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using Talon resin (Clontech), eluted in 200 mM imidazole ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and protein was incubated with Talon (Clontech), 0.5 ml resin per litre cell culture for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... the Capturem Protein A technology from Takara was employed according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... subtilis Secretory Protein Expression System (TAKARA Bio). For signal peptide library transformation into B ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Immunology 2019Quote: ... before transferred to Retronectin pre-coated plate (50ug/ml; Clontech). Lentivirus encoding gRNA or scramble control were added to the cells and spun down at 2000rpm for 20min ...
-
bioRxiv - Plant Biology 2020Quote: The Arabidopsis Mate and Plate Library were used (Clontech, 630487). Full-length protein for βC1 was cloned into the pGBT9 vector to generate BD-βC1 construct ...
-
bioRxiv - Immunology 2022Quote: ... into 96-well plates containing 2 µL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... TSC were transduced by spinoculation on retronectin-coated plate (Takara) with 1:1 mixture of culture medium and retroviral supernatant ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2023Quote: Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA ...
-
bioRxiv - Molecular Biology 2020Quote: A codon-optimized synthetic gene corresponding to the full length nucleocapsid protein (Thermo GeneArt, Regensburg, Germany) was cloned into a modified pET28a vector using the In-Fusion cloning kit (Takara Bio Saint-Germain-en-Laye, France). The resulting plasmid encoded for an N-terminal His6 tag followed by thrombin and tobacco etch virus cleavage sequences upstream of the full-length nucleocapsid protein sequence ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...