Labshake search
Citations for Takara Bio :
351 - 400 of 1426 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti- dsRed (1:500; Takara Bio), guinea pig anti-Loaf (1:400 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-DsRed 1:1000 (Clontech, #632496), mouse anti-Arm 1:3 (Hybridoma Bank ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed (Clontech, 632496, 1:200), mouse anti-Tubulin (Sigma T5168 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:500, Clontech #632496), goat anti-rat 647 (1:400 ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-DsRed (Clontech, Mountain View, CA) and chicken anti-GFP (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... 1:400 rabbit anti-DsRed (632496, Clontech), 1:800 mouse anti-mGluR1a (556389 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed (1:1000, 632496, Clontech); rabbit anti-HA (1:300 ...
-
bioRxiv - Neuroscience 2019Quote: ... or rabbit DsRed (1:500; Takara Clontech) at 4°C overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... or rabbit DsRed (1:500; Takara Clontech) at 4°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1/500, Clontech, 632496). Sections were then incubated for 2 h at room temperature with appropriate fluorescent secondary antibodies diluted in PBS – 1% normal serum ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1:1000) (632496, Clontech), goat anti-CGRP (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-DsRed (1:500; ClonTech). The secondary antibodies Cy3 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit α-DsRed (1:600, Clontech, #632496); rat α-mCherry (1:2000 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:500, Clontech #632496), goat anti-mCherry (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (1:500, Clontech). Secondary antibodies used were Alexa Fluor 633 goat anti-mouse ...
-
bioRxiv - Developmental Biology 2019Quote: ... Rabbit anti-Dsred (1:100; Takara, 632496), Mouse anti-Trio (1:100 ...
-
bioRxiv - Physiology 2019Quote: ... rabbit anti-DsRed (1:500, #632496 Clontech), mouse anti-Neurofilament-M (1:50 ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-dsRed (1:200, Takara, #632496), Alexa488 goat anti-mouse (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-dsRed (1:100, Clontech, 632496), Rabbit anti-Neuroglian (1:50 ...
-
bioRxiv - Genetics 2020Quote: ... including rabbit anti-RFP (Clontech, 1:1000), mouse anti-V5 (MCA1360GA ...
-
β-importins Tnpo-SR and Cadmus and the small GTPase Ran promote ovarian cyst formation in DrosophilabioRxiv - Developmental Biology 2021Quote: ... rabbit anti-dsRed (#632496, Clontech; 1:500), rabbit anti-phosphoHistone H3 (pHH3 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:400, Clontech 632496), chicken anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-DsRed (1:500, rabbit, Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed (1:200, Takara, #632496), Alexa488 goat anti-mouse (1:500 ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-DsRed (rabbit, 1/300, Takara, 632496), anti-Parvalbumin (mouse IgG1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and rabbit anti-dsRed (1:1000; Takara). The following corresponding Alexa Fluor™ conjugated secondary antibodies (1:750 ...
-
bioRxiv - Genetics 2022Quote: ... rabbit anti-DsRed express (Clontech, 1:250) and mouse anti-Bruchpilot (nc82 ...
-
bioRxiv - Neuroscience 2022Quote: ... or anti-DsRed (rabbit, ClonTech; 1:300) to stain against Tomato ...
-
bioRxiv - Neuroscience 2023Quote: ... and rabbit anti-mCherry (1:1000, TaKaRa Living Colors DsRed Polyclonal Ab 632496) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:500; TaKaRa #632496), rat anti-Cadherin DN (1:30 ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-DsRed (1:1000, rabbit; Clontech). Secondary antibodies used were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed express (Clontech, 1:250), mouse anti-Bruchpilot (nc82 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed (1:500; Clontech, 632496), rat anti-DAT (1:500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-DsRed (1:500, rabbit, Takara Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed (Clontech at 1:300), mouse anti-Claudin-5 (4C3C2 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (Clontech, 632496; RRID: AB_10013483), and chicken anti-GFP (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-dsRed (1:200, Clontech#632496), mouse anti-Nc82 (1:40 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit-anti mCherry (Takara Bio Clontech; 632496), rabbit anti-CART (55–102 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit-anti-zsGreen (Takara, 632474, 1:500), chicken-anti-mCherry (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... dsRed anti-rabbit (1:500, Clontech, 632496), c- Fos anti-rabbit (1:200 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed (1:1000, Clontech #632496), mouse anti-RFP (Invitrogen (RF5R) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-dsRed (1:500, Takara Bio), guinea pig anti-Sdk (1:200 ...