Labshake search
Citations for Takara Bio :
351 - 400 of 1630 citations for 6H Furo 2 3 g 3 benzazepine 2 ethyl 7 8 9 10 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Genomics 2021Quote: ... The Chip was then centrifuged at 1200xg for 3 min into a collection tube (Takara Cat# 640048). To remove residual PCR primers and detergent ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2019Quote: ... 3 washes with NT3 and final elution with 25 μl of elution buffer (Clontech, Machery-Nagel 740609.250).
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Plant Biology 2020Quote: Yeast two-hybrid analysis was employed using the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio, Japan) as previously described (Umezawa et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was bound to 3 mL (=1.5 mL bed volume) Talon SuperFlow Metal Affinity Resin (TaKaRa) per protein preparation ...
-
bioRxiv - Molecular Biology 2022Quote: The yeast two hybrid assay was performed as indicated in MATCHMAKER GAL4 two-hybrid system 3 (Clontech). The protein coding regions of genes used in this study were amplified from Guy11 cDNA with primer pairs listed in Table 1.1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genome fragments of each AQP gene were PCR-amplified using MightyAmp DNA polymerase ver.3 (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were diluted to 25,000 cells/mL and dispensed into ICELL8 3’ DE chips (Takara Bio, CA) using an MSND device (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... Products with 3’-dA overhangs were cloned into T-Vector pMD19 (Simple) (Takara Bio Inc., Shiga, Japan) to use as a template for sequencing.
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP (JL-8, Clontech) or Vinculin (7F9 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Plant Biology 2024Quote: ... and inserted into BamHI-digested pGEX-4T-3 by using In-Fusion Smart Assembly Cloning Kit (Takarabio-Clontech). Full-length OcKSL4 cDNA was amplified by RT-PCR using primers 5’-GGATCCATGGCGAATTATCCCATGGAG-3’ (forward ...
-
bioRxiv - Molecular Biology 2022Quote: ... ceranae-inoculated workers’ midguts at 7 dpi and 10 dpi were respectively isolated using RNA Extraction Kit (TaKaRa company, Dalian, China). cDNA was synthesized through reverse transcription with oligo dT primer and used as templates for qPCR assay ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... Yeast transformation was conducted with Yeast Transformation System 2 (Clontech NO.630439). All primers used were listed in supplementary Table 1.
-
bioRxiv - Microbiology 2020Quote: ... 2 µl of dNTP mix (TaKaRa, 2.5 mM concentration, 200 µM final), 0.125 µl of HotStart ExTaq (TaKaRa ...
-
bioRxiv - Microbiology 2019Quote: ... ISC5 and ISC5 groups using Advantage 2 Polymerase Mix (TAKARA, Kusatsu, Japan). 2µl of template with varying DNA concentration were used in a total of 50µl PCR reaction (S1 Dataset A) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...