Labshake search
Citations for Takara Bio :
351 - 400 of 2999 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
bioRxiv - Neuroscience 2024Quote: ... were designed using Primer3Plus (https://www.primer3plus.com/) and sequence accuracy was confirmed by SMARTer RACE 5’/3’ Kit (TaKaRa, Kusatsu, Japan) according to the manufacturer’s instruction ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR product was gel-purified and 400 ng of the purified product were used in a random priming reaction containing: 4 Units Klenow fragment (TAKARA, Japan), 5 μl 10x Klenow reaction buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Immunology 2021Quote: ... First strand cDNA synthesis was performed with 4 μg of total RNA per reaction using PrimeScript™ II 1st Strand cDNA Synthesis Kit and oligo-dT primer (TAKARA) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA libraries were synthesized with 4 ng of total RNA input to the Clontech SMARTer smRNA-seq kit (Takara Bio 635034) using the manufacturer’s suggested protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... We then aspirated the cell with as little buffer as possible and blew it into 4μl lysis buffer [4 units of Recombinant RNase Inhibitor (Takara, Cat.No.2313), 2.5μM poly(T)30VN primer (Sangon) ...
-
bioRxiv - Microbiology 2023Quote: ... 293T cells were cotransfected with 2.4 μg of proviral DNA construct and 0.6 μg of VSV-G expression vector using TransIT-LT1 reagent (Takara, Cat# MIR2306) into 293T cells (3 × 106) ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were fixed with ice-cold 4 % paraformaldehyde for 20 min and stained with rabbit anti-dsRed antibody (Takara Bio) and Alexa fluor 568-conjugated anti-rabbit secondary antibody to identify cells expressing mApple-tagged Myo6 ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were then run on a 4-12% Bis-Tris gel and transferred to a membrane for western blotting using α-GFP (Clontech) and α-HA (Cell Signaling Technology ...
-
bioRxiv - Developmental Biology 2022Quote: ... Co-IPs were carried out by incubating the samples with 30 μL of protein A agarose bead slurry for 4h at 4°C in a rotating wheel and with anti-mCherry (Takara 632496) of 1:1000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... StNPR1 or StNPR3/4 cds) construct combinations were transformed into the Y2H Gold strain using the Matchmaker Gold Yeast Two-Hybrid System (Clontech, USA) and the transformants selected on control SD media without Leu and Trp (-L-W) ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were centrifuged at 16,000 RCF for 5 min at 4°C and the supernatant was reserved for DNA clean-up using NucleoSpin® Gel and PCR Clean-Up (740609, Takara) based on manufacture instructions or ethanol precipitation.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Plant Biology 2020Quote: ... Membrane blocking was performed with 3%BSA in PBS-t buffer for 1 h at room temperature followed by incubation with Mouse-anti-GFP (TaKaRa) (1/5,000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... and a linker sequence (5’-GGTAGCGGCAGCGGTAGC-3’) were added through three additional PCR reactions using PrimeStar GXL DNA polymerase (Takara Bio). PCR products were gel-purified in each step ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts rising from the identified TSS were determined using the SMARTer Rapid amplification of cDNA ends (RACE) 5’/3’ kit (Takara Bio) in accordance with the manufacturer’s instructions for 3’ RACE ...
-
bioRxiv - Immunology 2021Quote: ... the isolated RNAs were subjected to first-strand cDNA synthesis using (5’-GTCGTATCCAGTGCAGGGTCCGAGGTCACTG GATACGACATACAACA-3’) by PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Japan). After that ...
-
bioRxiv - Genomics 2020Quote: ... the ORFs of all KRAB-transposase fusions except for KRABINER were synthesized as gBlocks (IDT) with 15bp of homology on the 5’/3’ end to facilitate In-Fusion cloning (Clontech, #638920) into either the pcDNA3.1+ (Addgene #V790-20 ...
-
bioRxiv - Cell Biology 2021Quote: ... zroraa LBD deletion DN -: 5′- ctgattatgatctagagtccaggccggattgatcagg-3 and inserted into a Tol2-lyzC-mcherry-2A backbone by using infusion cloning kit (Takara #638920). The construction method for neutrophil-specific Cas9 expression and the guide RNA expression fish lines has been described in our previous study [40] ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Plant Biology 2023Quote: ... the correct full-length sequences were determined for the laboratory strains using a SMARTer RACE 5’/3’ kit (Takara, Shiga, Japan). These sequences were aligned by ClustalW ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... the University of North Carolina at Chapel Hill) (43) and inserted back into pIZ-Msps-GFP digested with SspI(5’) and XhoI(3’) using Infusion ligation (Takara Bio) to create pIZ-Msps (RNAi-resistant)-GFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... reverse primer 5-TACCAAACTCTCAATTGCTC-3’) and the presence of small insertions and deletions assessed with the Guide-it Mutation Detection Kit (Takara Bio). The PCR amplicons were then inserted into pGEM vectors using the pGEM-T Easy Vector system (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Immunology 2024Quote: ... SMARTScribe reverse transcriptase (5 U/uL, Takara), Template-Switching Oligo (TSO ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was carried out to evaluate the syndecan-4 expression between lenti-synd4 shRNA and lenti-null group with SYBP Premix Ex Taq TM from Takara (Shiga, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Membranes were then incubated overnight on a shaker at 4°C in primary antibodies (ß-actin CST3700S; MLH1 Invitrogen MA5-32041; Cas9 Takara 632607) diluted 1:1000 in 1x TBST with 3% BSA ...
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
bioRxiv - Physiology 2024Quote: ... Homogenates were centrifugated at 1500 g for 10 minutes at 4°C before determining protein concentration by BCA assay (Takara Bio Inc.). Levels of 4-HNE-conjugated proteins were determined by Western blot ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...