Labshake search
Citations for Takara Bio :
351 - 400 of 2349 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 ng of RNA was mixed with 2 μl of PrimeScriptTM RT reagent kit (TaKaRa, RR037B) and distilled water (DW ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was applied to 2 mL slurry of TALON Metal Affinity Resin (Takara Bio #635504) and nutated for 1 hour to allow TALON to bind the His tagged protein ...
-
bioRxiv - Microbiology 2021Quote: ... 5 Units of ExTaq enzyme (Takara) supplemented with 10 μM of ATTO-550-aminoallyl-dUTP (Jena bioscience) ...
-
bioRxiv - Cell Biology 2023Quote: ... and pVSV-G (#PT3343-5, Clontech) vectors were transfected using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5× PrimeScript™ RT mix (TaKaRa) was used to acquire cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-caccgccatggtggcggatcccttgtacagctcgtccatgcc −3’) (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-cacgtctcatcccctccatctttgacctttcaaagtg - 3’) (Clontech). The full-length Tenm4 cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Microbiology 2024Quote: ... 5′ RACE was carried out using SMARTer RACE 5′/3′ Kit (Takara Bio USA, Mountain View, CA) to identify the transcription start site (TSS ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Cell Biology 2024Quote: ... 1× Titanium Taq buffer and 1 μL Titanium Taq (Clontech, 639209). PCR cycles were ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Cell Biology 2022Quote: ... full-length GIP-2 cDNA with a C-terminal V5-His6 tag was inserted into pColdI (TAKARA) and used to inoculate rabbits and rats ...
-
bioRxiv - Cell Biology 2023Quote: ... Yeast 2-hybrid (Y2H) analysis was performed using the protocols described in the Yeast protocols handbook (Clontech, Protocol No ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara).
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification was performed using the Advantage 2 Polymerase Mix (Clonetech, now Takara Bio USA, Mountain View, CA) and the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The virus particles were further concentrated at 10X in volume using Lenti-X-concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... Retrovirus was centrifuged for 2 hrs at 2560rcf at 320C onto wells pre-coated with RetroNectin (Takara). Wells were rinsed with PBS and CD8 T cells were added at 1×106 cells/mL in complete RPMI supplemented with 50 U/mL IL-2 and mouse T-activator Dynabeads (ThermoFisher ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara). Plasmid minipreps were performed using the NucleoSpin Plasmid Transfection-grade Mini kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... The NTD domain was purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... bfp and Pbdhfr 3’UTR gene sequences were amplified from plasmids Pb_MH21 and R6K-GW-BFP (PL_HC_001) respectively using Advantage 2 Polymerase Mix (TaKaRa). Individual fragments were assembled by stitch PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Six-well plates were coated with retronectin (50 µg/2 mL/well, (Takara Bio Inc., Kusatsu, Japan)) for 16 h ...
-
bioRxiv - Biochemistry 2024Quote: ... His-tagged ectodomain was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON) plus 18 µl 1 M CoCl2 to compensate for cobalt leaching away with the Expi293 Expression Medium ...