Labshake search
Citations for Takara Bio :
3901 - 3950 of 5541 citations for Galactose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized with the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (Takara/Clontech) and assessed with the Bioanalyzer high sensitivity DNA kit ...
-
bioRxiv - Microbiology 2021Quote: ... The four amplicons and a SacI-digested pUC19 vector were fused using an In-Fusion HD Cloning Kit (Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... The construction of a library was performed using a SMARTer Stranded RNA-Seq Kit (Clontech Lab Inc., CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was then synthesized from 1μg of total RNA from each sample using a PrimeScript 1st Strand cDNA synthesis kit (TaKaRa). Real-time RT-PCR was performed using the following primer sequences ...
-
bioRxiv - Developmental Biology 2021Quote: cDNA was synthesized using SMARTer Ultra Low Input RNA for Illumina Sequencing-HV kit (Clontech Laboratories; Cat. No. 634820) according to the manufacturer’s instructions and as previously published (Blakeley et al. ...
-
bioRxiv - Molecular Biology 2021Quote: The s2m sequence or control scrambled sequence of s2m (s2m_scr) was inserted into the 3’ UTR of GFP in H6P plasmid using In-Fusion Cloning kit (TaKaRa) and verified by sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... AAVS1 barcoded AAV6 donors were produced as described above but purified using a commercial purification kit (Takara Bio #6666).
-
bioRxiv - Plant Biology 2021Quote: ... Each RNA sample was reverse-transcribed to cDNA after DNase I treatment using a PrimeScript RT reagent kit (Takara). PCR was performed as described in Kumar et al ...
-
bioRxiv - Cell Biology 2020Quote: RNA samples were subjected to library preparation for the Illumina platform using the SMART-Seq Stranded Kit (Takara #634443) as manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and the resulting double-stranded fragments were subcloned at the BsaI site of the pMpGE_En03 vector (Sugano et al., 2018) using the DNA ligation kit Ver.2.1 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the samples using a NucleoSpin® RNA Plant kit (Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... An equal amount of RNA for each sample was converted to cDNA using PrimescriptTM RT Reagent Kit (Takara Bio), or Superscript IV (Thermofisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... by seamless cloning according to the instruction of In-fusion® HD Cloning Kit (Clontech, Palo Alto, CA, USA). NLS was inserted into pcDNA3.1 using High-Efficient Ligation Reagent Ligation High (TOYOBO) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products of EgGLUT1-ss gene were recovered from Agarose Gel with Agarose Gel DNA Extraction Kit (Takara, Japan), and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA libraries were prepared by the core using Takara’s SMART-seq v4 Ultra Low Input RNA Kit (Takara 634888) and sequenced on Illumina’s NovaSeq 6000 platform ...
-
bioRxiv - Microbiology 2021Quote: ... indexed cDNA libraries were prepared using the SMARTer Stranded RNA-Seq Kit (Takara Bio USA, Mountain View, CA, USA). Library preparation was performed according to the instructions ...
-
bioRxiv - Genetics 2022Quote: ... 1 µg of total RNA was used for reverse transcription using PrimeScript RT Reagent Kit (Cat#RR037A, TaKaRa, Japan). Quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Biochemistry 2022Quote: One μg of RNA per kidney half was reverse-transcribed using PrimeScript RT Reagent kit (RR037 TAKARA, Shiga, Japan). Two μl of cDNA was used for quantitative real-time PCR to assess gene mRNA expression ...
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and then was transcribed to cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was used for preparing cDNA using PrimeScript™ 1st strand cDNA Synthesis Kit (Clontech) following the manufacturer’s protocol.
-
bioRxiv - Genetics 2019Quote: ... First-strand cDNA was reverse transcribed from 1μg of total RNA using the PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa). Rice ubiquitin (UBQ ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sub-cloning was done by using the In-Fusion PCR cloning kit (Clontech Laboratories, Mountain View, CA, USA). Plasmids were integrated at the lys1 gene locus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Full length cDNA synthesis was done from polyA RNA using Clontech SMARTer PCR cDNA synthesis kit (Clontech Laboratories; (23)) ...
-
bioRxiv - Immunology 2019Quote: ... The libraries were prepared using the SMARTer® Stranded Total RNA-Seq - Pico Input Mammalian - kit (Takara Bio, USA) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... followed by self-circularization using the In-Fusion HD Cloning Kit (Cat# 639648, Clontech Laboratories, Mountain View, CA, USA).
-
bioRxiv - Immunology 2019Quote: ... cDNA and library preparation were performed with a SMART-Seq v4 Ultra Low Input RNA Sequencing Kit (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified genes were cloned in the pOPIN_S vector [40] using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified genes were cloned in the pOPIN_S vector [40] using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with 1.0 μg of scrambled or Rai1-shRNA-expressing plasmids with the CalPhos Transfection kit (ClonTech) or Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and pBS2_Pericentrin C-ter_InsR: CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F ...
-
bioRxiv - Immunology 2020Quote: ... and 250 ng RNA of each sample was reverse transcribed to cDNA using the Primescript RT kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized at 44°C for 15 min using the PrimeScript RT reagent kit with gDNA eraser (TaKaRa) and a y300 PAT universal C10 primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram of total RNA was reverse transcribed by the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, RR047A). Quantitative PCR was performed in technical duplicates with FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... The mRNA expression was quantified using the SYBR green PCR kit (TaKaRa SYBRR Premix Ex Taq. II, Dalian, China) in a CFX96 Touch apparatus (Bio-Rad ...
-
bioRxiv - Genomics 2019Quote: ... Amplified fragments containing 145 bp sequence were then cloned into pGL4.23 vector using In-Fusion HD Cloning kit (Clontech). The resulting constructs were co-transfected with renilla luciferase into melanoma cell lines (UACC903 and UACC502 ...
-
bioRxiv - Neuroscience 2020Quote: ... Library Preparation and mRNA Sequencing: The cDNA libraries were prepared using a SMART-Seq® HT Kit (TAKARA Bio) and a Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: Total RNAs were extracted using TRIzol reagent and reverse-transcribed into cDNAs using the PrimeScript RT reagent kit (TaKaRa). RT-qPCR was performed using KAPA SYBR FAST qPCR master mix (Kapa Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and were cloned into the KpnI restriction site of pEF-BOS using an In-Fusion Cloning Kit (TaKaRa Bio.). A FLAG-tag sequence was inserted just after the start codon ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... a DNA library of 220 bp insert size was prepared using the PrepX ILM 32i DNA Library Kit (Takara), and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat ...
-
bioRxiv - Biophysics 2019Quote: ... and the products were further purified in 3% agarose-TBE gels and subsequently reisolated using gel-purification kits (Clontech).
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was reverse transcribed with a PrimeScript II 1st strand cDNA Synthesis Kit (no. 6210A; Takara Bio, Kyoto, Japan). Based on the information at RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq) ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were converted to cDNA and amplified using Smart-Seq V4 Ultra Low Input RNA Kit (Takara Bio). The cDNA output was then processed with Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 [88] using the In-Fusion HD Cloning kit (Clontech) as described previously [89] ...
-
bioRxiv - Immunology 2021Quote: ... RNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Clontech/Takara). The input quantity of total RNA was comprised between 1 and 22ng ...
-
bioRxiv - Immunology 2021Quote: ... RNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Clontech/Takara). The input quantity of total RNA was comprised between 1 and 22ng ...
-
bioRxiv - Cell Biology 2021Quote: ... 1-2ug of RNA was used to synthesise cDNA using Superscript III or PrimeScript kit (Thermo Fisher Scientific, Takara). Quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... was then subcloned into the expression vector RH2.2 (kind gift of S. Sidhu) using the In-Fusion Cloning Kit (Takara) and sequence-verified.
-
bioRxiv - Molecular Biology 2020Quote: ... was purified using the manufacturer’s instructions and used to prepare libraries with SMART-Seq v4 Ultra Low Input RNA Kit (Clontech) followed by sequencing on a NextSeq 500 instrument (Illumina ...