Labshake search
Citations for Takara Bio :
3601 - 3650 of 6421 citations for Rat Epithelial membrane protein 1 EPN3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Physical viral titer was determined using either Lenti-X qRT-PCR Titration Kit (Takara, Mountain View, CA) or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... it was inserted into the pUAST attB vector using an In-Fusion® HD Cloning Kit (Clontech). The primer sequences used for the PCR are as follows ...
-
bioRxiv - Microbiology 2020Quote: ... or (ii) the SMARTer Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian libraries (Takara Bio USA) for ALG_1 and ALG_3 (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... The approximate titer of lentivirus was evaluated using a lentiviral titration kit (Lenti-X GoStix Plus; ClonTech). The lentiviral medium was transferred to 50 mL centrifuge tubes ...
-
bioRxiv - Microbiology 2021Quote: ... which was prepared with the ThruPLEX DNA-seq Kit (Takara Bio USA, Inc., Mountain View, CA, USA). 2 × 250 bp sequencing was performed using the Illumina HiSeq 2500 V4 platform ...
-
bioRxiv - Plant Biology 2021Quote: ... the RNA was converted into cDNA using PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA, 6210A) following the instruction in the manual ...
-
bioRxiv - Plant Biology 2021Quote: ... Applied Biosystem StepOne real-time PCR system and SYBR Premix Ex Taq II kit (Takara, Dalian, China) were used for the qRT-PCR detection ...
-
bioRxiv - Molecular Biology 2021Quote: ... In-Fusion cloning was performed using the In-Fusion® HD Cloning Plus Kit (Takara Bio, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Two PCR products were inserted into the vector backbone using In-Fusion HD Cloning Kit (Takara Bio) to generate pLJM1-LTR-FT ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were constructed using SMARTer Stranded Total RNA-seq Kit v2 – Pico Input Mammalian (Clontech), starting from 5ng total RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The final pQE-JAK3 construct was used to transfect GC using the Xfect transfection kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using a SYBR Premix Ex TaqTM kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was reverse transcribed to cDNA using the PrimeScript™ RT reagent Kit (TaKaRa, RR037A, Japan). Convergent and divergent primers were used to detect the expression of linear and circular RNA transcripts ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA libraries were prepared using SMART-seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa Bio), which is based on the SMART-seq2 method (Picelli et al. ...
-
bioRxiv - Microbiology 2022Quote: ... the fragments were sequentially ligated into the target vector using the In-Fusion HD Cloning Kit (Clontech). The resulting plasmid sequences were verified by Sanger sequencing (GATC Biotech ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... single-stranded cDNA was generated from RNA using the SMARTer cDNA synthesis kit (Clontech, Palo Alto, CA) with tagged oligo-dT primers that include one of eight 15-bp barcodes to distinguish individual samples (2 species x 2 tissues x 2 biological replicates) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Genomics 2022Quote: ... CH17-203N23 and CH17-449P15 BACs were extracted by using a NucleoBond Xtra BAC kit (Takara, 740436.25). ∼1 μg of BAC DNA was digested with 30 nM of sgRNAs (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: The cDNA synthesis was done using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech) and the library was prepared using Nextera XT DNA Library Prep kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets was collected and isolated for total RNA with MiniBEST Universal RNA Extraction Kit (Takara, #9767). Total RNA (1 μg ...
-
bioRxiv - Plant Biology 2021Quote: ... gDNA removal and first-strand cDNA synthesis were conducted by PrimeScriptTM RT reagent Kit (Takara, Beijing, China) with 0.5 μg total RNA for each sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2-Pico Input (634412, Takara). A total of 32 samples were sequenced for 50-bp single-end reads across 4 lanes on an Illumina HiSeq 2500 by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Neuroscience 2020Quote: ... The knock-in plasmid was constructed by using In-Fusion HD Cloning kit (Takara Bio USA #639650) or NEBuilder HiFi DNA Assembly kit (New England Biolabs #M5520 ...
-
bioRxiv - Molecular Biology 2020Quote: The cDNA synthesis kits and SYBR Green Master Mix were obtained from Clontech (Mountain View, CA, USA). Dexamethasone and Granzyme B inhibitor Z-AAD-CMKwere purchased from Sigma-Aldrich (St ...
-
bioRxiv - Molecular Biology 2020Quote: DNA ligation was performed using standard ligation techniques (Takara DNA Ligation kit ver. 2.1; Takara, Otsu, Japan). For transformation ...
-
bioRxiv - Neuroscience 2020Quote: ... spectrophotometer followed by reverse transcription reaction to produce cDNA using PrimeScript RT Reagent Kit (Takara, Clonetech, Japan). Specific primers against the genes of interest (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on StepOne Plus Real-time PCR system (Applied Biosystem ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription of RNAs were carried out using PrimeScript II 1st strand cDNA Kit™ (Takara, Japan). The coding sequences of DGAT1s were amplified by a high-fidelity KOD-Plus-Neo polymerase (Toyobo ...
-
bioRxiv - Biochemistry 2021Quote: pRM823 (pUC118-bamA) was constructed by in vitro recombination using In-Fusion HD cloning kit (Takara Bio) of a EcoRI-BamHI fragment from pUC118 and a bamA fragment prepared by PCR amplification from the genome of MC4100 using a pair of primers ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from equivalent total RNA using PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara #634894) according to the manufacturer’s instructions except that 10 µL instead of 9 µL was used to optimize for low RNA input ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from PSCs and vesicles by Mini BEST Universal RNA Extraction Kit (Takara, Japan), as previously described (66) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Bioengineering 2021Quote: ... an endotoxin-free plasmid midiprep DNA purification took place using NucleoBond Xtra Midi EF kit (Takara Bio) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Systems Biology 2022Quote: ... cDNA was generated using the SMART-Seq V4 Ultra Low RNA Kit (Takara Bio, Mountain View, CA). After 14 cycles of library amplification ...
-
bioRxiv - Molecular Biology 2022Quote: Single cells were prepared using the STORM-seq protocol (referencing the SMART-Seq Stranded Kit – Takara Bio) on the SPT Labtech Mosquito (HV) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and cDNA was synthesized with the PrimeScript RT reagent Kit with the gDNA Eraser (TaKaRa Bio Inc.). Real-time PCR was performed using the KOD SYBR qPCR Mix (TOYOBO ...
-
bioRxiv - Microbiology 2019Quote: ... The two DNA fragments were then ligated with In-Fusion HD Cloning kit (TaKaRa Bio Inc., Japan) to generate pKLC5 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... cDNA synthesis and amplification was performed using the SMARTer Ultra Low RNA Kit for Illumina sequencing (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequencing libraries were generated using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634413). Compared to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed as recommended in the BD Matchmaker Library Construction and Screening kit (Clontech, USA). The complete coding sequence of PRH1 was fused to the GAL4 DNA binding domain (BD ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR reactions were performed using a SYBR® Premix Ex Taq™ II Kit (TaKaRa, China) and a CFX96 real-time PCR detection system (BIO-RAD ...