Labshake search
Citations for Takara Bio :
3501 - 3550 of 5147 citations for Mouse CXCL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The In-Fusion® reaction was performed using the In-Fusion® HD Cloning Plus Kit (Takara Bio, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by ELISA (eBiosciences ...
-
bioRxiv - Genomics 2021Quote: ... we determined the lentiviral integration site using a protocol adapted from Lenti-X Integration Site Analysis Kit (Takara Bio) and oligonucleotides oJY0104-oJY0109.
-
bioRxiv - Biochemistry 2020Quote: ... Amplified genes were cloned into an altered pFastBacHT B vector using the In-Fusion HD EcoDry Cloning Kit (Clontech). After transformation of DH10EMBacY E ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (1 mg) was reverse transcribed using the PrimeScript RT Reagent Kit with the gDNA Eraser (TAKARA, Japan). Quantitative PCR reactions were performed using the gene-specific primers of FLC and FT (Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was isolated as described above and reverse transcribed into cDNA with the prime Script RT reagent kit (Takara). 10 ng of cDNA was used in a 1X reaction consisting of 12.5 µl TB Green Premix Ex Taq II (Tli RNaseH plus ...
-
bioRxiv - Cancer Biology 2020Quote: ... They are routinely tested for contamination of mycoplasma by using PCR Micoplasma Test Kit (Takara Bio Inc., Shiga, Japan) and confirmed to be negative before performing experiments.
-
bioRxiv - Developmental Biology 2022Quote: ... 30 ZP-free embryos were lysed in 1x Lysis Buffer containing RNase inhibitor (0.2 IU/µl, from SMART-Seq Stranded Kit, Clontech), directly ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The MSCV wildtype murine ADAR2 overexpression construct was generated using the In-Fusion HD Cloning Plus kit (Takara Bio). Specifically ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Cancer Biology 2022Quote: ... MG63.3 libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411) while 143b-HOS-GFP libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Immunology 2022Quote: ... Library preparation was performed using the ClonTech SMARTer Stranded RNA-SEq Kit V2 for mammalian pico RNA input (Takara) and RNA sequencing was performed using HiSeq 2500 sequencer with 50bp read lengths (Illumina).
-
bioRxiv - Genomics 2022Quote: Sequencing libraries were prepared using 1-10 ng of cfDNA and the ThruPLEX® Plasma-seq Kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 500 ng total RNA using a Prime Script RT Reagent Kit (Takara Bio, Otsu, Japan). RT- PCR was performed using three primer sets ...
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... The titer of the produced lentivirus was determined by using Lenti-X Gostix Plus Titer Kit (Takara, cat# 631281). To generate AMOT knockdown cell line ...
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Microbiology 2022Quote: ... SMART-Seq v4 Ultra Low Input Kit for Sequencing was used for full-length cDNA synthesis and amplification (Clontech), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... First-stand cDNA was reverse transcribed from 1.5 μg of total RNA using the Prime Script reagent kit (Takara).
-
bioRxiv - Plant Biology 2022Quote: ... ligated into the BamHI and KpnI restriction sites of the pOPINF vector91 using the In-Fusion kit (Clontech Takara) and transformed into chemically competent E ...
-
bioRxiv - Plant Biology 2022Quote: ... ligated into the BamHI and KpnI restriction sites of the pOPINF vector91 using the In-Fusion kit (Clontech Takara) and transformed into chemically competent E ...
-
bioRxiv - Plant Biology 2022Quote: ... The location of T-DNA in mt2 was confirmed by using the GenomeWalker kit (Clontech Laboratories, Mountain View, CA) following the manufacturer’s recommended protocols ...
-
bioRxiv - Plant Biology 2022Quote: ... aril and kernel tissues were pooled equally and cDNA was synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech). Size fractionation and selection (1-2 ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: First-strand cDNA was synthesized from total RNA using the PrimeScript First-Strand cDNA Synthesis Kit with PrimeScript Reverse Transcriptase according to the manufacturer’s protocols (TAKARA). To 1 ug of RNA ...
-
bioRxiv - Neuroscience 2023Quote: cDNA libraries were prepared using the SMARTer® Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio) following manufacturer’s instructions in ten batches ...
-
bioRxiv - Neuroscience 2022Quote: ... purified RNA samples were converted to cDNA using the SMART-seq v4 Ultra Low Input RNA Kit (Takara Bio), and cDNA libraries were generated with the Nextera XT DNA Library Preparation Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was resuspended in cold PBS and titre was determined using Lenti-X p24 Rapid Titre Kit (Takara Bio) according to manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA-seq libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara, 634412). Libraries were sequenced on the Illumina MiSeq platform ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2022Quote: ... and a subset (approximately 75,000 cells) was pelleted prior to RNA extraction using the NucleoSpin RNA Plus XS kit (Takara) following manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... cDNAs synthesized from the extracted total RNAs using a PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA, Japan) were used as templates to perform qPCR assays for the checking of the transcriptions of VEGFA ...
-
bioRxiv - Plant Biology 2024Quote: ... a genomic DNA walk was carried out using the Universal Genome Walker 2.0 Kit (Takara Bio Inc. Company, USA). Genomic DNA was isolated using DNeasy ® Plant Mini Kit (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... then cDNA was synthesized according to the PrimeScript TM II 1st Strand cDNA Synthesis Kit (Takara Bio, Dalian, China). Real-time PCR analysis was performed with the LightCycler 480 SYBR Green I Master (Roche ...
-
MALAT1 mediates miR-206/CDC42/PAK1/Paxillin signaling axis to alleviate erectile dysfunction in ratsbioRxiv - Molecular Biology 2024Quote: ... and the extracted total RNA was used to remove DNA using the DNA Eraser Buffer kit (TaKaRa, Beijing, China). And the obtained RNA was used for reverse transcription using the PrimeScript RT Enzyme Mix I kit (TaKaRa) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized at 44°C for 15 min using the PrimeScript RT reagent kit with gDNA eraser (TaKaRa) and the y300 PAT universal C10 primer ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500 ng of RNA template was subjected to in vitro reverse transcription using PrimeScript RT Reagent Kit (Takara, RR037). After elution with 40 ul of DNase/RNAse free water ...
-
bioRxiv - Genetics 2024Quote: ... purified by phenol chloroform extraction and then reverse transcribed with a PrimeScript™ RT Reagent Kit (TAKARA, Dalian, China) according to the manufacturers’ protocol.
-
bioRxiv - Plant Biology 2024Quote: ... First-strand complementary DNA (cDNA) was synthesized using a PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China). SYBR Premix ExTaqTM (TaKaRa ...