Labshake search
Citations for Takara Bio :
3501 - 3550 of 5300 citations for Human Gastrin Cholecystokinin Type B Receptor CCKBR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... strand cDNA was synthetized using the TaKaRa PrimeScipt RT Reagent Kit (Cat# RR037A, Takara Bio Inc., Kusatsu, Japan) using 20 µM Random decamer first strand primers according to the manufactorer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... In-fusion assembly with the 2 fragments was performed using the In-fusion snap assembly kit by Takara Bio.
-
bioRxiv - Genomics 2024Quote: Sequencing libraries were prepared from isolated RNA using two different kits: Takara SMART-Seq v4 3′ DE (Takara) and Lexogen QuantSeq 3′ (Lexogen ...
-
bioRxiv - Cell Biology 2024Quote: ... One microgram of total RNA was subjected to first strand cDNA synthesis using PrimeScript RT Reagent kit (Takara). The target cDNA was amplified using TB Green Premix Ex Taq II (Takara ...
-
bioRxiv - Cell Biology 2024Quote: ... One microgram of total RNA was subjected to first strand cDNA synthesis using PrimeScript RT Reagent kit (Takara). The target cDNA was amplified using TB Green Premix Ex Taq II (Takara ...
-
bioRxiv - Genetics 2024Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the Prime Script RT kit (Takara, RR047A). The SYBR Green qPCR master mix (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... Ligation of the various components was undertaken using an In-Fusion cloning kit (Takara Bio-Europe, Paris, France). The ligation reaction was transformed into Stellar competent cells as per manufacturer protocols ...
-
bioRxiv - Genetics 2024Quote: ... Complementary DNA (cDNA) was synthesized from total RNA using a PrimeScript RT reagent Kit (Cat. no. RR047B, TaKaRa) and was used as a template to perform qPCR in TB green-based qPCR instrument (CFX-96 ...
-
bioRxiv - Immunology 2024Quote: ... Viral titer (p24 core antigen content) was determined initially using a LentiX GoStix Plus titration kit (Takara #631280) and subsequently by HIV p24 AlphaLISA detection kit (PerkinElmer # AL291C) ...
-
bioRxiv - Microbiology 2024Quote: ... Then dual-indexing library preparation was created in equimolar conditions following the SMARTSeq Library Prep kit (Takara Bio) and Illumina sequencing 2x 150 reads was done on a Novaseq SP by Fasteris-GeneSupport SA (Switzerland) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and upstream fragment) were connected using the In-Fusion reaction (In-Fusion HD Cloning Kit, Takara, Shiga, Japan) to construct the LBDG_21500-disrupting plasmid (Table S9).
-
bioRxiv - Neuroscience 2024Quote: ... ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech cat# 634936) per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech cat# 634936) per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg of RNA was reverse transcribed using PrimeScript™ RT reagent kit (Takara, San Jose, CA), according to manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... The first-strand cDNA was synthesized from genomic DNA-removed RNA by using PrimeScript™ RT reagent kit (TaKaRa). Next ...
-
bioRxiv - Immunology 2021Quote: ... 1ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... The mutated NLRP3-D303N and NLRP3-L353P were generated using the PrimeSTAR Mutagenesis Basal kit (Takara Bio, Shiga, Japan) (Aizawa et al. ...
-
bioRxiv - Immunology 2021Quote: ... The first-strand cDNA synthesis was performed with the Prime Script RT Master Mix kit (Takara Bio Europe, France). Quantitative real-time PCR was performed at 60°C using Takyon ROX SYBR MasterMix (Eurogentec ...
-
bioRxiv - Immunology 2021Quote: ... was used to for two-step qPCR assay after cDNA synthesis using PrimeScript® reverse transcriptase kit (Takara, Japan). Gene expression was normalized to the expression level of β-actin ...
-
bioRxiv - Microbiology 2021Quote: ... The entire fragment was then infused into a pCAGGS expression vector using an Infusion HD cloning kit (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... ssDNA was purified using the Nucleospin Gel and PCR Clean-up kit (Machery-Nagel, distributed by Takara Bio USA) with buffer NTC used as recommended by the manufacturer ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... while those with <15ng were prepared using the SMARTer® ThruPLEX® DNA-Seq Kit (Takara Bio Inc, Japan) in the sensi-lab at NHM Oslo (Table S1) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Complementary DNA libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (TAKARA Bio) and Nextera XT DNA Library Prep kit (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... a sequence region of 5,000 bp between SnaBI and AgeI restriction sites was amplified using the HiFi amplification kit (Clontech, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2022Quote: ... Equal volume RNAs were subjected to reverse transcription using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan). Distribution of mat mRNAs or mat-exon1 mRNAs in transfected cells was assessed using SBYR-Green (Takara ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 500 ng total RNA using a Prime Script RT Reagent Kit (Takara Bio, Otsu, Japan). qRT-PCR was performed using a StepOne Real-time PCR Instrument (Applied Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 g RNA was used to synthesize the cDNA using reverse transcription M-MLV (RNase-free) kits (TaKaRa, Japan). qRT-PCR was performed with SYBR green PCR master mix (ToYoBo ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcription (RT) was performed using a PrimeScript® RT Reagent Kit with gDNA Eraser (RR047A, TaKaRa, Dalian, China) in a 20 μL reaction mixture containing 1 μg of total RNA from each individual sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Bioengineering 2022Quote: ... and TP–mAG were ligated into the open circular pET-29b(+) using the In-Fusion HD Cloning Kit (TaKaRa) to generate the recombinant protein expression vectors ...
-
Nulliparity affects the expression of a limited number of genes and pathways in Day 8 equine embryosbioRxiv - Developmental Biology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... https://www.addgene.org/112849/)10 between the EcoRI and SpeI restriction sites by multi-cassette assembly using the InFusion cloning kit (Takara Inc.). The correct sequence of the donor region was validated by Sanger sequencing.
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Plant Biology 2019Quote: The 5’ ends of the viral genomes sequences were determined or confirmed using the 5’ Rapid Amplification of cDNA Ends (RACE) strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA Sequencing libraries were prepared with SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). RNA isolated from 1000 cells was used as starting material ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). Single cells were used directly as starting material without RNA extraction to avoid extra loss of RNA ...
-
bioRxiv - Neuroscience 2019Quote: ... and CaMPARI was fused to synaptophysin using the In-Fusion® HD Cloning method and kit (Takara Bio USA) after amplifying variants of CaMPARI with PCR using custom primers with base pair overhangs homologous to the synaptophysin plasmid (3’ Primer [CGATAAGCTTTTATGAGCTCAGCCGACC] ...
-
bioRxiv - Biochemistry 2019Quote: ... The PCR product was inserted into the linearized pGL4.17[luc2/Neo] vector by In-Fusion reaction using In-Fusion HD Cloning Kit (Takara). The URAT1/SLC22A12 promoter + pGL4.17 plasmid was transformed into the E ...
-
bioRxiv - Molecular Biology 2021Quote: Input and immunoprecipitated DNA were used to prepare multiplexed libraries using the ThruPLEX® DNA-Seq Kit (Takara Bio) and DNA Unique Dual Index Kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... was collected from 1.0 μg of sheared DNA (median, 200 bp) using an EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA (30 ng) was used for synthesis of cDNA with PrimerScript RT reagent kit with gDNA eraser (TAKARA BIO). QPCR was performed with TB Green Premix Ex-taq II (TAKARA BIO) ...
-
bioRxiv - Genomics 2020Quote: ... 1ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA).
-
bioRxiv - Plant Biology 2020Quote: ... This was followed by a nested PCR and cloning of the products using the Mighty TA-cloning kit (TaKaRa). Twenty independent clones were randomly picked and sequenced.
-
bioRxiv - Plant Biology 2020Quote: Ptr1 candidate genes were cloned from LA4277-Ro (Ptr1/Ptr1) cDNA into pBTEX (Table S7) using the In-fusion cloning kit manufacturer’s instructions (Takara). StPtr1 was cloned from Dakota Crisp potato plants (Solanum tuberosum ...