Labshake search
Citations for Takara Bio :
301 - 350 of 958 citations for Dengue Virus Serotype 3 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Enhanced green fluorescent protein (EGFP, Clontech), Tag-blue fluorescent protein (Tag-BFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... protein was estimated using BCA (TaKaRa), and 100 µg protein was incubated with 20 µl packed protein G-sepharose beads (Sigma P3296 ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Biochemistry 2021Quote: ... an aliquot of the lysate was used to measure protein concentration by BCA protein assay (Takara Bio). The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were determined via the Bradford method using the TaKaRa Bradford Protein Assay Kit (Takara Bio, T9310A).
-
bioRxiv - Plant Biology 2021Quote: Protein-protein interactions via yeast-two-hybrid (Y2H) assays were performed as described in the Matchmaker protocol (Clontech). HvRACB (amino acids 1-193 ...
-
bioRxiv - Biochemistry 2023Quote: ... Uncleaved protein and cleaved His6-Ztag domains were separated from cleaved protein by incubation with TALON resin (Clontech). The supernatant was buffer exchanged to MES A buffer (20 mM MES ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Microbiology 2020Quote: Tissue protein lysates were purchased from Takara. Details for each lysate are shown in Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... cell-free protein expression system from Takara Bio Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using Talon resin (Clontech), eluted in 200 mM imidazole ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and protein was incubated with Talon (Clontech), 0.5 ml resin per litre cell culture for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... the Capturem Protein A technology from Takara was employed according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... subtilis Secretory Protein Expression System (TAKARA Bio). For signal peptide library transformation into B ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2023Quote: Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2019Quote: ... and both proteins were separated from each other and from a protein encoded by blasticidin resistance gene (cloned from pQCXIB #631516, Clontech) by self-cleavage peptide P2A ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4) and the protein contents of the cell lysate were quantified using a BCA Protein Assay Kit (TAKARA, T9300A) following the manufacturer’s protocol (Song et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatants were collected and mixed with Laemmli buffer after measuring the protein concentration using a TaKaRa BCA Protein Assay Kit (TaKaRa). Samples were subjected to SDS-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene difluoride membranes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eukaryotic expression vectors encoding green fluorescent protein (GFP)-tagged proteins were generated by inserting PCR-amplified fragments into pd1-EGFP-N1 vector (6073-1, Clontech). Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01 ...
-
bioRxiv - Genomics 2020Quote: ... CAS9 protein was purchased from Clontech (Cat # 632641). For injection ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using amylose-agarose resin (Clontech) and eluted in 10 mM maltose ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration was determined by Bradford assay (TAKARA). Nickel affinity purification of 10His-SUMO1T95R conjugates was carried out with Ni-NTA agarose beads (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were bound to TALON IMAC resin (Clontech) overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purified using TALON resin (Takara Bio) using standard protocols in 50 mM phosphate buffer pH7.4 containing 300mM NaCl.