Labshake search
Citations for Takara Bio :
301 - 350 of 1837 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: LR-PCR amplification reaction was performed using PrimeSTAR GXL DNA Polymerase kit (Takara) according to manufacturer”s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Cell Biology 2020Quote: The mouse Tacc3 sequence was amplified by PrimeSTAR® Max DNA polymerase (TAKARA) using forward 5’-CTCCCCAGGGGGATCATGAGTCTGCATGTCTTAAAT-3’ and reverse 5’-GAGGTTGATTGTCGATCAGATCTTCTCCATCTTAG-3’ primers ...
-
bioRxiv - Biophysics 2021Quote: ... All site-specific mutants were prepared using PrimeStar DNA Taq Polymerase (Takara Clonetech). Expression and purification of recombinant wild-type and mutant RXFP1(1-72) ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ACP were amplified by PCR with PrimeSTAR Max DNA Polymerase (Takara). The primers for PCR were listed in the S1 Table ...
-
bioRxiv - Cancer Biology 2022Quote: ... the products were amplified with PrimSTAR® Max DNA Polymerase (TaKaRa bio Inc.). The vector arms and PCR products were combined by incubating them for 1 hour at 50°C in the Gibson Assembly reaction buffer (5% PEG-8000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... VAL2 and VAL3 were amplified by PCR (PrimeSTAR TM HS DNA Polymerase, TaKaRa) using the plasmids carrying the full-length cDNA of each gene as template ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Genomic regions of interest were amplified using Primestar Max DNA polymerase (Takara, # R045A) and primers HGTpcrF ...
-
bioRxiv - Plant Biology 2021Quote: ... Gene fragments were amplified using PrimeStar HS DNA polymerase (Takara Bio, Kusatsu, Japan) and cloned into the vector using In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed with PrimeSTAR Max DNA polymerase (Takara Bio Inc, Shiga, Japan) with the following parameters ...
-
bioRxiv - Molecular Biology 2021Quote: ... Candidate BgElo genes were amplified with the PrimeSTAR GXL DNA Polymerase reagent (Takara) (primers are listed in S4 Table) ...
-
bioRxiv - Cell Biology 2021Quote: ... tricornutum gDNA with PrimeSTAR GXL DNA Polymerase (Takara Bio, Kusatsu, Japan, Catalog #R050B) and primer set JT31/JT32 to incorporate the appropriate Gibson Assembly overhangs and remove the predicted N-terminal signal peptide (amino acid residues 1–18) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic barcode amplification was performed using Titanium Taq DNA polymerase (Clontech-Takare 639208) with a maximum of 50ng of DNA per reaction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Long-range PCRs were performed with PrimeSTAR GXL DNA Polymerases (Takara Bio Europe). Initial sequences generated following Bourguignon et al ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed with 2x SeqAMP buffer and SeqAmp DNA polymerase (Takara USA) and for the final amplification ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed with 2x SeqAMP buffer and SeqAmp DNA polymerase (Takara USA) and for the final amplification ...
-
bioRxiv - Microbiology 2021Quote: ... using random hexamers and PCR was performed with PrimeSTAR Max DNA Polymerase (Takara). Primers were designed based on the assembled viral contigs ...
-
bioRxiv - Microbiology 2020Quote: ... Following PCR amplification with TaKaRa Ex Taq DNA Polymerase (ClonTech, Mountain View, CA), the PCR product and pRRK plasmid were digested with the XBaI restriction endonuclease (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... The ORF3b derivatives were generated by PCR using PrimeSTAR GXL DNA polymerase (Takara), the synthesized ORFs as templates ...
-
bioRxiv - Immunology 2022Quote: ... and the S gene was amplified using PrimeSTAR GXL DNA Polymerase (Takara, JP) for next-generation sequencing.
-
bioRxiv - Immunology 2022Quote: ... and the S gene was amplified using PrimeSTAR GXL DNA Polymerase (Takara, JP) for next-generation sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PrimeStar DNA polymerase and SapphireAmp* Fast PCR Master Mix were purchased from TaKaRa Bio ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.2 mM dNTPs and 0.5 U TaKaRa rTaq DNA polymerase (TaKaRa, Otsu, Japan). The amplification was carried out by PCR involving a denaturation step at 94 °C for 3 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The target genomic region was amplified with PrimeSTAR GXL DNA Polymerase (Takara Bio) using a set of primers (Supplementary Table 1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... For each PCR reaction we used: 0.75 μL of ExTaq DNA polymerase (Clontech), 5 μL of (10x ...
-
bioRxiv - Molecular Biology 2022Quote: ... then mixed with universal primer and PrimeSTAR GXL DNA polymerase (Takara, Cat# R050A) and amplified following the program ...
-
Phenogenomic resources immortalized in a panel of wild-derived strains of five species of house micebioRxiv - Evolutionary Biology 2023Quote: ... The ZnF array was PCR amplified using PrimeSTAR HS DNA Polymerase (Takara Bio) and primers Prdm9-F (TGAGATCTGAGGAAAGTAAGAG ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR reaction was performed using PrimeSTAR Max DNA Polymerase (Takara Bio., Japan) with the following thermal cycling parameters ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA inserts were PCR amplified using Ex Taq DNA Polymerase (Takara, cat#RR001A) from sufficient genome equivalents of DNA to achieve an average coverage of >200x of the sgRNA library ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA inserts were PCR amplified using Ex Taq DNA Polymerase (Takara, cat#RR001A) from sufficient genome equivalents of DNA to achieve an average coverage of >200x of the sgRNA library ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments including the mutations inserted were obtained by RT-PCR using PrimeSTAR GXL DNA polymerase (Takara, cat# R050A) and the following primers ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was used as template for PCR using TaKaRa Ex Taq or PrimeSTAR GXL DNA polymerase (Takara Bio), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification from genomic and plasmid DNA templates was performed using PrimeStar Max DNA polymerase (Takara Bio, Kusatsu, Japan) or GoTaq Master Mix (Promega ...
-
bioRxiv - Genomics 2020Quote: ... The 50 µl PCR reaction contains 1.25 U PrimeSTAR GXL DNA Polymerase (Takara, R050), 1X PrimeSTAR GXL Buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... insert and vector fragments were generated by PCR using PrimeSTAR Max DNA Polymerase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNA was subjected to PCR using ExTaq DNA polymerase (Takara Co., Otsu, Japan) or PrimeSTAR GXL DNA polymerase kit (Takara Co.) ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR amplification was performed using PrimeSTAR HS DNA polymerase (TAKARA Bio Inc., Kusatsu, Japan) with/without GC buffer for accurate amplification of GC rich targets ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was amplified using using PrimeSTAR HS DNA Polymerase (Takara Bio Inc., cat. R040A) and the primers GFP F AgeI 72 and GP80 R XhoI 64 (Table S1) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 72°C 1’) of target regions with Ex Taq HS DNA polymerase (Takara Bio). The PCR products were purified enzymatically with ExoSAP-IT Express PCR product cleanup (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... EPM master mix was replaced with the PrimeSTAR GXL DNA Polymerase kit (Takara, Japan), following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... The full sequences were amplified by LA Taq DNA polymerase (TaKaRa Biotechnology, Dalian, China) under the following conditions ...
-
bioRxiv - Cancer Biology 2022Quote: sgRNA sequences were amplified from gDNA by PCR using Ex Taq DNA polymerase (TaKaRa). PCR mixes were prepared with 10 µL 10X reaction buffer ...
-
bioRxiv - Microbiology 2020Quote: ... a diagnostic PCR analysis was performed using LA Taq® DNA polymerase (Takara, Japan), the primers listed in table S2 and gDNA obtained from the Pfvps60 KO strain and compared with the WT 3D7 strain ...
-
bioRxiv - Neuroscience 2020Quote: Coding sequence of CROCCP2 was amplified by PCR using Prime Star DNA polymerase (TAKARA) from GW9 human fetal cortex cDNA ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by second strand synthesis using a tagging primer with MightyAmp DNA polymerase (TAKARA) (98°C for 130 sec ...
-
bioRxiv - Molecular Biology 2020Quote: The cleavage substrate was amplified using overlap-PCR (PrimeSTAR GXL DNA Polymerase from Takara) from the random PAM plasmid library (see Supplementary Materials and Methods) ...