Labshake search
Citations for Takara Bio :
301 - 350 of 5440 citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... using the SYBR Premix Ex Taq II (Takara, Japan), using a BioRad Chromo4 real-time PCR machine ...
-
bioRxiv - Immunology 2020Quote: ... with TB Green Premix Ex Taq II (RR820A; Takara). The primer sequences used in this study are listed in Table 2.
-
bioRxiv - Cell Biology 2021Quote: ... or TB Green Premix Ex Taq II (Takara, RR820A) was used according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... using TB Green Premix Ex Taq II (Takara, Japan). The qRT-PCR assays were performed with technical triplicates of three biological replicates ...
-
bioRxiv - Immunology 2022Quote: ... or TB Green Premix Ex Taq II (TaKaRa Bio). All data are presented as relative expression levels normalized to Hprt expression ...
-
bioRxiv - Microbiology 2022Quote: ... and Thermal Cycler Dice Real Time System II (Takara). All primers used in this study are listed in Table S5 (No ...
-
bioRxiv - Microbiology 2022Quote: ... and Thermal Cycler Dice Real Time System II (Takara). Three biologically independent experiments were performed and used for the analysis.
-
bioRxiv - Plant Biology 2022Quote: ... 10 μl SYBR Premix Ex Taq II (Takara, Japan), and nuclease-free water ...
-
bioRxiv - Molecular Biology 2023Quote: ... on Thermal Cycler Dice Real Time System II (TaKaRa). The relative mitochondrial DNA content normalized by nuclear-genome content was determined using the ΔΔCt method.
-
bioRxiv - Genetics 2023Quote: ... and TB Green Premix Ex TaqTM II (Takara, RR820A) in a StepOne real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... and SYBR Premix Ex Taq II (Takara, Shiga, Japan) with gene-specific primers (S4 Table ...
-
bioRxiv - Cell Biology 2023Quote: ... and TB Green Premix Ex Taq II (TaKaRa Bio). In each sample ...
-
bioRxiv - Cell Biology 2023Quote: ... using SYBR® Premix Ex Taq™ II (TaKaRa). Specific primers for RPL13 ...
-
bioRxiv - Plant Biology 2024Quote: ... 10 µL SYBR Premix Ex Taq II (Takara, China), 1 µL (200 nM final concentration ...
-
bioRxiv - Cell Biology 2024Quote: ... using SYBR® Premix Ex TaqTM II (TaKaRa, Japan). All primer information for each target gene was obtained from the Primerbank website(https://pga.mgh.harvard.edu/primerbank/) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... (ii) ectoderm differentiation was induced with NDiff (NB27 Takara #y40002) supplemented with 0,25 μM Retinoic Acid (Sigma Aldrich#R2625) ...
-
bioRxiv - Immunology 2021Quote: ... with TB Green Premix Ex Taq II (Takara Cat no.RR820A). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... using the TB Green Ex Taq II polymerase (Takara RR820L). Each reaction was performed in triplicate ...
-
bioRxiv - Microbiology 2020Quote: ... and TB Green Premix Ex Taq II (Takara Bio Inc.). The sequences of Pck1 and Cpt1a primers were referred to a previous report 44,45 ...
-
bioRxiv - Genomics 2022Quote: ... ligated with pUC118/Hinc II BAP (Cat# 3322, Takara Bio), and used to transform E ...
-
bioRxiv - Genomics 2019Quote: ... and SYBR Premix Ex Taq™ II (TaKaRa, Tokyo, Japan). The qRT-PCR was performed using the following steps ...
-
bioRxiv - Cell Biology 2019Quote: ... Reverse transcription was carried out using PrimeScript II (Takara, 6210A) and random hexamers ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... Purified RNA was reverse-transcribed using PrimeScript II (Takara Bio) with oligo-dT and random primers ...
-
bioRxiv - Plant Biology 2019Quote: ... SYBR® Premix Ex Taq™ II (TAKARA Bio Inc) and specific primers designed with the Primer3web program (http://primer3.ut.ee ...
-
bioRxiv - Developmental Biology 2021Quote: ... A Thermal Cycler Dice Real-Time System II (Takara Bio) was used for qPCR reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... and reverse-transcribed using PrimeScript II reverse transcriptase (Takara Bio). Full-length cDNA was amplified using Ex Taq (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... and SYBR Premix Ex Taq II (Takara Bio, Shiga, Japan) under the following conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... TB Green Premix Ex Taq II (Takara Bio, Kusatsu, Japan). All qPCR primers are listed in Table S2.
-
bioRxiv - Bioengineering 2024Quote: ... TB Green Premix Ex Taq II (12.5 µL; Takara Bio), and nuclease-free water (8.5 µL) ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...