Labshake search
Citations for Takara Bio :
301 - 350 of 2126 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Quantification of P11+1 SH-10 cells showed that 76% of cells were expressing hLAG3 upon induction by 1 µg/ml of Doxycycline (DOX; Clontech #631311). This decreased to 59% in P11+2 and remained around 50% in the following passages ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used for the purpose of inserting Capn4 into pCWX200 and pLexA were ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentivirus was produced in DMEM containing 10% FBS and 1% BSA and then concentrated by the Lenti-X concentrator (Takara Bio).
-
bioRxiv - Genomics 2024Quote: Illumina sequencing libraries are prepared by incorporating 1-10 ng of cfDNA with the ThruPLEX® Plasma-seq Kit by Takara Bio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The mixture (1 μL) was used as the template in 10 μL of PrimeSTAR GXL DNA Polymerase (Takara Bio Inc., Japan) reaction ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was pre-amplified by adding 2 uL of cDNA from each sample to 8 uL of preamp master mix [5 uL TaKaRa premix Taq polymerase (Clontech), 2.5 uL 0.2X Taqman pooled probe ...
-
bioRxiv - Molecular Biology 2019Quote: ... Same volume of samples were loaded on 4-16% gradient SDS-PAGE gels and analyzed by western blot analysis using EGFP (JL-8; Clontech), penta-HIS (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins induced by 1 mM IPTG entered inclusion bodies and were extracted with 8 M urea and purified with TALON Metal Affinity Resin (Takara) under denaturing conditions ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 ng total RNA was reverse transcribed and full-length cDNA was specifically amplified by 8 PCR cycles using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech) (31) ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Biophysics 2022Quote: ... The stability of the fusion constructs was verified by gel electrophoresis and immunoblotting using an anti-GFP primary antibody (JL-8 monoclonal, Takara). Point mutations were introduced by site-directed mutagenesis (New England Biosciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV1-syn-F14F15S-sTpEptTA_v2 were made by transfecting 8×15c plates (per virus) of HEK 293T cells using Xfect transfection reagent (Takara 631318). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins corresponding to the full-neck regions of myosin VIIIs were solubilized using 8 M urea and purified using a Ni-NTA His60 column (Takara), or for GST-tandem-IQ fusions ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... We froze 5 μL of the supernatant in 45 μL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, Takara Bio Inc.) before analysis by polymerase chain reaction (PCR) ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells grown in 10 ml of medium (3.0 x 105 cells/ml) were transfected with 10 µg of pCAGGS-NP (1-450) using TransIT-293 Reagent (Takara, Shiga, Japan). Three days post-transfection ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of Mixture (TaKaRa, Japan), 1 μL upstream primers (10 μmol/L ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μL of Clone AMP (Takara), and 300 nM each of primers ks1 and mf83 ...
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: ... 10% Tet system approved FBS (Takara), 100 units/ml penicillin and 100 μg/ml streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 10% Fetal Bovine Serum (Clontech). Cells were grown at 37°C with 5% CO2 and passaged using 0.05% Trypsin-EDTA solution (Thermo Fisher ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 10% Tet Approved FBS (Clontech Laboratories), and 1X Penicillin/Streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... 10-15 µg of EGFP (Clontech) was coated onto 6-8 mg of 1.6 µm gold beads.
-
bioRxiv - Plant Biology 2022Quote: ... using 10 pmol random nonamers (Takara) in 20 μl reaction volume and according to manufacturers’ instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 10% FBS (Takara Bio, 631368) and 1x penicillin-streptomycin in 24-well glass-bottomed No ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Synthetic Biology 2024Quote: ... supplemented with 10% FBS (Takara 632180). LentiX cells (Takara 632180 ...
-
bioRxiv - Molecular Biology 2021Quote: ... DMEM supplemented with 10% fetal bovine serum (FBS) and 10 μl DNase I (Takara Bio, Shiga, Japan) was then added to the samples and incubated for 5 min at room temperature (RT) ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...