Labshake search
Citations for Takara Bio :
301 - 350 of 2223 citations for 7 Oxa 1 2 diazaspiro 4.4 non 1 en 6 one 4 methyl cis 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... anti-GFP JL8 (Clontech, 1:2000), anti-V5 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-Dsred (1:200)(Takara), mouse anti-Lacz (1:200)(Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 mM dNTPs (Takara Bio, #639125), 4 mM MgCl2 ...
-
bioRxiv - Immunology 2022Quote: ... Shield-1 was obtained from Clontech and was used at a final concentration of 2.5 μM.
-
bioRxiv - Neuroscience 2020Quote: ... DsRed (rabbit; 1:500, 632496 Takara), TH (mouse ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (Clontech, rabbit 1:500), anti-PV (Sigma PARV-19 ...
-
bioRxiv - Cell Biology 2021Quote: ... ZsProSensor-1 (Takara Bio, Tokyo, Japan). This reporter consists of a green fluorescent protein ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:2000 ds-red (Takara Bio). Sections were then washed 3 × 10 min in PBS-T ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (Clontech, 1:1000), goat anti-HRP-Cy5 (Dianova ...
-
bioRxiv - Cancer Biology 2021Quote: ... Shield-1 (Takara Bio USA, Inc), Aqua-Shield-1 (AS1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (Clontech, 1:1000), or mouse anti-brp (nc82 ...
-
bioRxiv - Molecular Biology 2019Quote: 1 μg brain mRNA (Takara Bio) or 10 μg of brain total RNA (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-DsRed (1:500; Clontech) and rat anti-GFP (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 U RNAse inhibitor (Takara, 2313A) and 1M betaine (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit-α-DsRed (1:1000, Clontech), goat-DsRed (1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-dsRed (Clontech #632496, 1:300), anti-c-Myc (Santa Cruz #SC40 ...
-
bioRxiv - Physiology 2020Quote: ... rabbit anti-dsRed 1:250 (Clontech), Cy-3 anti-rabbit 1:400 (Millipore) ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-dsRed (1:400, Clontech), and mouse anti-GFP (1:200 ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL RNAiso Plus reagent (TakaRa) was added to each bacterial cell pellet and mixed vigorously by pipetting ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-FOXG1 (1:500, rabbit; Takara), anti-MAP2 (1:500 ...
-
bioRxiv - Immunology 2022Quote: ... and pPE ampho (1 μg, Takara) using 12 μl of Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg/ml of puromycin (Takara) was added to the medium only for two days.
-
bioRxiv - Neuroscience 2023Quote: ... anti-Crx (rabbit; 1:200; Takara), anti-Recoverin (rabbit ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit dsRed (1:250, Takara, 632496), and DAPI ...
-
bioRxiv - Cancer Biology 2023Quote: ... For STEM121 (1:5000, Takara, #Y40410) and Ki67 (1:100 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μg/ml Doxycycline (Dox) (Clontech) was added into PGC-cultured FAcs medium 24 hours before the injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... His6 (631212, Clontech, mouse, 1:500); NPL4 (sc-365796 ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Myc (1:1000) (Clontech); rabbit anti-HA (1:800 ...
-
bioRxiv - Genomics 2023Quote: ... 1 Unit ExTaq (Takara, catalog #RR001A), 0.2 µM primer 1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... DsRed (Clontech, cat#632392, 1:500), GFP (Thermo ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:1000, Clontech), mAb anti-Bruchpilot (nc82 ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 (Clontech #C3003-1; lot #7030396) cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
bioRxiv - Bioengineering 2023Quote: ... and Stem123 (Takara Y40420; 1:500). The following secondary antibodies were used at a 1:800 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Ocn (Takara, M173; 1:800), anti-CD31 (BD ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of RNaseH (TaKaRa, 2150A), and 1 µL of RNase cocktail (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... GFP (1:1,000, JL-8, Clontech), GABARAP/Atg8a (1:2,000 ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in primary antibody (1:1,000 mouse anti-calbindin, Sigma; 1:500 rabbit anti-DsRed, Clontech; 1:1,000 guinea pig anti-vGluT1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... primary antibodies (chicken anti-GFP, Abcam, ab13970, 1:2000 and rabbit anti-DsRed, Clontech, 632496, 1:200) were incubated overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-st PCR (PCR 1) was performed using Titanium Taq DNA Polymerase (# 639209, Takara Bio, CA, USA). Separation of the PCR products from primers and gel purification was done by QIAquick PCR & Gel Cleanup Kit (Qiagen ...