Labshake search
Citations for Takara Bio :
301 - 350 of 2552 citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The beads were then suspended in TdT reaction buffer (1× NEBuffer #4, 0.25 mM CoCl2, 15 U TdT (Takara Bio), 20 Ci α-32P-dCTP [6000 Ci/mmol]) ...
-
bioRxiv - Neuroscience 2019Quote: ... In situ hybridization was followed by incubation at 4°C overnight with a rabbit anti-dsRed (1:3000, Clontech: 632475) primary antibody ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were incubated overnight at 4°C in primary antibody diluted in PBS (1:100 monoclonal mouse anti-GFP; 632380, Clontech). After washing with PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated overnight at 4°C with primary antibody diluted in blocking buffer (these were: 1:200 Living Colors Ab, #632380, Takara; 1:100 L-plastin ...
-
bioRxiv - Microbiology 2021Quote: ... 6 μL of Reverse Transcriptase Buffer (5x First strand buffer (TaKaRa 639538), Betaine (Sigma B0300 ...
-
bioRxiv - Molecular Biology 2021Quote: ... transferred onto nitrocellulose and detected with either mouse anti-6×His (Clontech) at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript ...
-
bioRxiv - Molecular Biology 2020Quote: ... EBs were transferred into coated 6-well plates (DEF-CS COAT, Takara) at a density of 30 EBs per well in IVD medium and harvested after 7 days.
-
bioRxiv - Immunology 2023Quote: ... Random primer (Hexadeoxyribonucleotide mixture, pd(N)6) (3801) was purchased from Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... in 6-well plates pre-coated with 15 ug retronectin (Takara T100A). Plates were spinfected by centrifugation at 2500 rpm 32C for 90 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 6 ml Lenti-X Concentrator (Takara Bio; Cat. No. 631231), mixed thoroughly ...
-
bioRxiv - Microbiology 2023Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction mixtures mixed with a 6×loading buffer (Takara, Beijing, China) were loaded into the gel ...
-
bioRxiv - Genetics 2020Quote: Gal4-based Matchmaker Two-Hybrid System 3 (Clontech) was used according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using MightyAmp™ DNA Polymerase Ver.3 (TaKaRa) and ND5 universal primers (Table S3) ...
-
bioRxiv - Microbiology 2022Quote: ... The two-hybrid system Matchmaker 3 from Clontech was used as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: The Matchmaker Yeast Two-Hybrid System 3 (Clontech) was used for yeast two-hybrid assays to examine the p3 interaction with NbP3IP ...
-
bioRxiv - Cell Biology 2023Quote: Gal4-based Matchmaker Two-Hybrid System 3 (Clontech) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... viral stocks were concentrated by adding supernatant at a 3:1 ratio to Lenti-X Concentrator (631232, Takara Bio, Mountain View, CA). Mixtures were incubated overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were analyzed using a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan) on Applied Biosystems QuantStudio ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were analyzed using a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan) on an Applied Biosystems QuantStudio ...
-
bioRxiv - Cancer Biology 2019Quote: ... One μg RNA was used for cDNA synthesis with RNA to cDNA EcoDry™ premix (TaKaRa) containing both random hexamer and oligo(dT)18 primers (Double Primed) ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR was performed with the One Step TB Green PrimeScript RT-PCR Kit II (TaKaRa), and SYBR Green was used as a fluorescent dye for detection ...
-
bioRxiv - Microbiology 2023Quote: ... One microgram of RNA was transcribed into cDNA using the PrimerScript RT Reagent Kit (Takara, Japan). After reverse transcription ...
-
bioRxiv - Molecular Biology 2023Quote: Y1H assays were performed using the Matchmaker Gold Yeast One-Hybrid Library Screening System (Clontech, USA). The sequence of LhWRKY44 was inserted into the vector pGADT7 as prey ...
-
bioRxiv - Microbiology 2023Quote: ... One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (RR096A, Takara Bio Inc.), and primer pairs for Zcchc3 (5′-CTCTCTATGCCTTCTTAAACCGA-3′ and 5′-CATCTGCACGCTACAGTTCT-3′ ...
-
bioRxiv - Genetics 2023Quote: ... One-third of the total media volume of Lenti-X Concentrator (631232, Takara Bio, Shiga, Japan) was added to the viral media and refrigerated for 30 minutes at 4°C before being centrifuged for 45 minutes at 1500g and 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Synthetic Biology 2019Quote: ... AAV9-G505R was generated by PCR mutagenesis of p5E18-VD2/9 using the In-Fusion Cloning HD Plus System (Takara Bio, Mountain View, CA). The pITR-CCR5-PGK-GFP vector genome plasmid contains AAV2 ITRs ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Microbiology 2019Quote: ... (5’-GGT CTC TCT GGT TAG ACC AGA TCT GAG C-3’ and 5’-AAA CAT GGG TAT TAC TTC TGG GCT GAA AG-3’) using PrimeSTAR®HS (TAKARA) and purified by QIAquick Gel Extraction (QIAGEN) ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM dithiothreitol (Clontech), 2 μM template switching oligo (Exiqon) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... and then in primary antibodies in PBST at 4°C for 48 hours using rabbit anti-DsRed (mCherry tag; 1:500; Clontech; 632496), and mouse anti-Th (1:1,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was carried out with 1 μg of RNA using the PrimeScript RT reagent kit (Takara-#RR037A-4). The cDNA was diluted and semiquantitative and Real-time PCR techniques were performed ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...